EMAIL THIS PAGE TO A FRIEND

FAM83H

family with sequence similarity 83, member H

47 Gene Product Result for
Synonyms: AI3
UniProtKB ID: Q6ZRV2, A0JLS2, Q8N4W0
Gene ID:
Human(286077) Summary: The protein encoded by this gene plays an important role in the structural development and calcification of tooth enamel. Defects in this gene are a cause of amelogenesis imperfecta type 3 (AI3). [provided by RefSeq, Mar 2010]
Mouse(105732) family with sequence similarity 83, member H
Rat(362937) family with sequence similarity 83, member H
Zebrafish(565437) family with sequence similarity 83, member H
cow(524974) family with sequence similarity 83, member H
domestic cat(101091760) family with sequence similarity 83, member H
dog(482081) family with sequence similarity 83, member H
chicken(426293) family with sequence similarity 83, member H
domestic guinea pig(100734037) family with sequence similarity 83, member H
naked mole-rat(101714325) family with sequence similarity 83, member H
sheep(101116996) family with sequence similarity 83, member H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198488 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198488 Rosetta Predictions human pricing
NM_001130565 Rosetta Predictions rat pricing
NM_134087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372050 predicted 1876
2 SASI_Hs01_00215887 predicted 955
3 SASI_Hs01_00215889 predicted 1806
4 SASI_Hs01_00215890 predicted 3426
5 SASI_Hs01_00215891 predicted 673
6 SASI_Hs01_00215892 predicted 344
7 SASI_Hs01_00215893 predicted 265
8 SASI_Hs01_00215894 predicted 240
9 SASI_Hs01_00215895 predicted 3569
10 SASI_Hs02_00372051 predicted 654
11 SASI_Hs01_00215888 predicted 1880
12 SASI_Hs01_00215896 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255819 predicted 857
2 SASI_Rn02_00255820 predicted 212
3 SASI_Rn02_00255821 predicted 613
4 SASI_Rn02_00255822 predicted 3681
5 SASI_Rn02_00255823 predicted 3744
6 SASI_Rn02_00255824 predicted 3863
7 SASI_Rn02_00255825 predicted 2659
8 SASI_Rn02_00255826 predicted 1022
9 SASI_Rn02_00255827 predicted 3430
10 SASI_Rn02_00255828 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158309 predicted 3828
2 SASI_Mm01_00158310 predicted 882
3 SASI_Mm01_00158312 predicted 1416
4 SASI_Mm02_00339313 predicted 3597
5 SASI_Mm01_00158313 predicted 891
6 SASI_Mm01_00158314 predicted 824
7 SASI_Mm01_00158315 predicted 2617
8 SASI_Mm01_00158316 predicted 980
9 SASI_Mm01_00158317 predicted 2721
10 SASI_Mm01_00158318 predicted 316
11 SASI_Mm01_00158311 predicted 3648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134087
VALIDATED
FAM83H MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member H
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-823s21c1
Sequence:CCGGGTAGTGATGAGCGGCAGTTATCTCGAGATAACTGCCGCTCATCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134087.1-2610s21c1
Sequence:CCGGGTCTCCACAAGGTCGAGATAGCTCGAGCTATCTCGACCTTGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-3773s21c1
Sequence:CCGGTGCCATACTGAACCTACAATACTCGAGTATTGTAGGTTCAGTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-774s1c1
Sequence:CCGGGTCTTTCAAGGGCCATCTAAACTCGAGTTTAGATGGCCCTTGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-774s21c1
Sequence:CCGGGTCTTTCAAGGGCCATCTAAACTCGAGTTTAGATGGCCCTTGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-736s21c1
Sequence:CCGGACAGTGGCAGGTCCTACTTACCTCGAGGTAAGTAGGACCTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-169s1c1
Sequence:CCGGCCACCTCACTACAAAGAATATCTCGAGATATTCTTTGTAGTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-3305s1c1
Sequence:CCGGGCAATCTGCGAGATGACACTACTCGAGTAGTGTCATCTCGCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134087.1-4329s1c1
Sequence:CCGGGCTAGGACAGACTGTTGGAAACTCGAGTTTCCAACAGTCTGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134087
VALIDATED
FAM83H MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member H
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-823s21c1
Sequence:CCGGGTAGTGATGAGCGGCAGTTATCTCGAGATAACTGCCGCTCATCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134087.1-2610s21c1
Sequence:CCGGGTCTCCACAAGGTCGAGATAGCTCGAGCTATCTCGACCTTGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-3773s21c1
Sequence:CCGGTGCCATACTGAACCTACAATACTCGAGTATTGTAGGTTCAGTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-774s1c1
Sequence:CCGGGTCTTTCAAGGGCCATCTAAACTCGAGTTTAGATGGCCCTTGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-774s21c1
Sequence:CCGGGTCTTTCAAGGGCCATCTAAACTCGAGTTTAGATGGCCCTTGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-736s21c1
Sequence:CCGGACAGTGGCAGGTCCTACTTACCTCGAGGTAAGTAGGACCTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-169s1c1
Sequence:CCGGCCACCTCACTACAAAGAATATCTCGAGATATTCTTTGTAGTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-3305s1c1
Sequence:CCGGGCAATCTGCGAGATGACACTACTCGAGTAGTGTCATCTCGCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134087.1-4329s1c1
Sequence:CCGGGCTAGGACAGACTGTTGGAAACTCGAGTTTCCAACAGTCTGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134087
VALIDATED
FAM83H MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member H
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-823s21c1
Sequence:CCGGGTAGTGATGAGCGGCAGTTATCTCGAGATAACTGCCGCTCATCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134087.1-2610s21c1
Sequence:CCGGGTCTCCACAAGGTCGAGATAGCTCGAGCTATCTCGACCTTGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-3773s21c1
Sequence:CCGGTGCCATACTGAACCTACAATACTCGAGTATTGTAGGTTCAGTATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-774s1c1
Sequence:CCGGGTCTTTCAAGGGCCATCTAAACTCGAGTTTAGATGGCCCTTGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-774s21c1
Sequence:CCGGGTCTTTCAAGGGCCATCTAAACTCGAGTTTAGATGGCCCTTGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134087.1-736s21c1
Sequence:CCGGACAGTGGCAGGTCCTACTTACCTCGAGGTAAGTAGGACCTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-169s1c1
Sequence:CCGGCCACCTCACTACAAAGAATATCTCGAGATATTCTTTGTAGTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134087.1-3305s1c1
Sequence:CCGGGCAATCTGCGAGATGACACTACTCGAGTAGTGTCATCTCGCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134087.1-4329s1c1
Sequence:CCGGGCTAGGACAGACTGTTGGAAACTCGAGTTTCCAACAGTCTGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198488
VALIDATED
FAM83H MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member H
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3412s1c1
Sequence:CCGGCCATGATGTTCTTGTGGGCATCTCGAGATGCCCACAAGAACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3201s1c1
Sequence:CCGGCCTAAGAGGGAACTGATTTAACTCGAGTTAAATCAGTTCCCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-1852s1c1
Sequence:CCGGGAAGTCCAACTACAGGATTTACTCGAGTAAATCCTGTAGTTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3200s1c1
Sequence:CCGGCCCTAAGAGGGAACTGATTTACTCGAGTAAATCAGTTCCCTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-2438s1c1
Sequence:CCGGCAAGGACAAGTGTTCAGCCATCTCGAGATGGCTGAACACTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198488.1-1849s1c1
Sequence:CCGGGAGGAAGTCCAACTACAGGATCTCGAGATCCTGTAGTTGGACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198488
VALIDATED
FAM83H MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member H
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3412s1c1
Sequence:CCGGCCATGATGTTCTTGTGGGCATCTCGAGATGCCCACAAGAACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3201s1c1
Sequence:CCGGCCTAAGAGGGAACTGATTTAACTCGAGTTAAATCAGTTCCCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-1852s1c1
Sequence:CCGGGAAGTCCAACTACAGGATTTACTCGAGTAAATCCTGTAGTTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3200s1c1
Sequence:CCGGCCCTAAGAGGGAACTGATTTACTCGAGTAAATCAGTTCCCTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-2438s1c1
Sequence:CCGGCAAGGACAAGTGTTCAGCCATCTCGAGATGGCTGAACACTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198488.1-1849s1c1
Sequence:CCGGGAGGAAGTCCAACTACAGGATCTCGAGATCCTGTAGTTGGACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198488
VALIDATED
FAM83H MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member H
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3412s1c1
Sequence:CCGGCCATGATGTTCTTGTGGGCATCTCGAGATGCCCACAAGAACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3201s1c1
Sequence:CCGGCCTAAGAGGGAACTGATTTAACTCGAGTTAAATCAGTTCCCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-1852s1c1
Sequence:CCGGGAAGTCCAACTACAGGATTTACTCGAGTAAATCCTGTAGTTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-3200s1c1
Sequence:CCGGCCCTAAGAGGGAACTGATTTACTCGAGTAAATCAGTTCCCTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198488.1-2438s1c1
Sequence:CCGGCAAGGACAAGTGTTCAGCCATCTCGAGATGGCTGAACACTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198488.1-1849s1c1
Sequence:CCGGGAGGAAGTCCAACTACAGGATCTCGAGATCCTGTAGTTGGACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks