EMAIL THIS PAGE TO A FRIEND

FAM84A

family with sequence similarity 84, member A

Synonyms: NSE1 PP11517
UniProtKB ID: Q96KN4, A6NP76, Q86UZ2, Q8NAH7, Q8TAM5
Gene ID:
Mouse(105005) family with sequence similarity 84, member A
Rat(313969) family with sequence similarity 84, member A
Zebrafish(393590) family with sequence similarity 84, member A
chicken(421946) family with sequence similarity 84, member A
domestic cat(101093516) family with sequence similarity 84, member A
cow(539071) family with sequence similarity 84, member A
dog(610235) family with sequence similarity 84, member A
sheep(101105319) family with sequence similarity 84, member A
naked mole-rat(101719602) family with sequence similarity 84, member A
domestic guinea pig(100718356) family with sequence similarity 84, member A
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145175 Rosetta Predictions human pricing
NM_001127299 Rosetta Predictions rat pricing
NM_029007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070143 predicted 388
2 SASI_Hs01_00070144 predicted 243
3 SASI_Hs01_00070145 predicted 1608
4 SASI_Hs01_00070146 predicted 1472
5 SASI_Hs01_00070148 predicted 845
6 SASI_Hs01_00070149 predicted 773
7 SASI_Hs01_00070150 predicted 1276
8 SASI_Hs01_00070151 predicted 850
9 SASI_Hs02_00365032 predicted 1468
10 SASI_Hs02_00365033 predicted 474
11 SASI_Hs01_00070147 predicted 1563
12 SASI_Hs01_00070152 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253553 predicted 1214
2 SASI_Rn02_00253554 predicted 1911
3 SASI_Rn02_00253555 predicted 514
4 SASI_Rn02_00253556 predicted 615
5 SASI_Rn02_00253557 predicted 657
6 SASI_Rn02_00253558 predicted 1578
7 SASI_Rn02_00253559 predicted 595
8 SASI_Rn02_00253560 predicted 1312
9 SASI_Rn02_00253561 predicted 1906
10 SASI_Rn02_00253562 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047300 predicted 965
2 SASI_Mm01_00047301 predicted 847
3 SASI_Mm01_00047302 predicted 858
4 SASI_Mm01_00047303 predicted 305
5 SASI_Mm01_00047304 predicted 1572
6 SASI_Mm01_00047305 predicted 1432
7 SASI_Mm01_00047306 predicted 1295
8 SASI_Mm01_00047307 predicted 248
9 SASI_Mm01_00047308 predicted 778
10 SASI_Mm01_00047309 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029007
FAM84A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 84, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-979s1c1
Sequence:CCGGGTATTATCTCAAAGTGCATCTCTCGAGAGATGCACTTTGAGATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-976s1c1
Sequence:CCGGGCAGTATTATCTCAAAGTGCACTCGAGTGCACTTTGAGATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-1111s1c1
Sequence:CCGGCTTTGTGGACGACAAGGAGTACTCGAGTACTCCTTGTCGTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-971s1c1
Sequence:CCGGCAACAGCAGTATTATCTCAAACTCGAGTTTGAGATAATACTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029007.2-2622s1c1
Sequence:CCGGCCTGATGTTTATTTCTGAGAACTCGAGTTCTCAGAAATAAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029007
FAM84A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 84, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-979s1c1
Sequence:CCGGGTATTATCTCAAAGTGCATCTCTCGAGAGATGCACTTTGAGATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-976s1c1
Sequence:CCGGGCAGTATTATCTCAAAGTGCACTCGAGTGCACTTTGAGATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-1111s1c1
Sequence:CCGGCTTTGTGGACGACAAGGAGTACTCGAGTACTCCTTGTCGTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-971s1c1
Sequence:CCGGCAACAGCAGTATTATCTCAAACTCGAGTTTGAGATAATACTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029007.2-2622s1c1
Sequence:CCGGCCTGATGTTTATTTCTGAGAACTCGAGTTCTCAGAAATAAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029007
FAM84A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 84, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-979s1c1
Sequence:CCGGGTATTATCTCAAAGTGCATCTCTCGAGAGATGCACTTTGAGATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-976s1c1
Sequence:CCGGGCAGTATTATCTCAAAGTGCACTCGAGTGCACTTTGAGATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-1111s1c1
Sequence:CCGGCTTTGTGGACGACAAGGAGTACTCGAGTACTCCTTGTCGTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029007.2-971s1c1
Sequence:CCGGCAACAGCAGTATTATCTCAAACTCGAGTTTGAGATAATACTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029007.2-2622s1c1
Sequence:CCGGCCTGATGTTTATTTCTGAGAACTCGAGTTCTCAGAAATAAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145175
FAM84A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 84, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-1985s1c1
Sequence:CCGGCGCTTATTGTTCTGAACCCTTCTCGAGAAGGGTTCAGAACAATAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-2123s1c1
Sequence:CCGGCCAGTATATTTAGTTTGGCTTCTCGAGAAGCCAAACTAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-2117s1c1
Sequence:CCGGCCATAGCCAGTATATTTAGTTCTCGAGAACTAAATATACTGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145175.1-959s1c1
Sequence:CCGGGCAGCAGCAGTACTATCTCAACTCGAGTTGAGATAGTACTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145175.1-965s1c1
Sequence:CCGGGCAGTACTATCTCAAGGTGCACTCGAGTGCACCTTGAGATAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145175.2-315s21c1
Sequence:CCGGCCACCTCAACTACAGCGAGTTCTCGAGAACTCGCTGTAGTTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145175
FAM84A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 84, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-1985s1c1
Sequence:CCGGCGCTTATTGTTCTGAACCCTTCTCGAGAAGGGTTCAGAACAATAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-2123s1c1
Sequence:CCGGCCAGTATATTTAGTTTGGCTTCTCGAGAAGCCAAACTAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-2117s1c1
Sequence:CCGGCCATAGCCAGTATATTTAGTTCTCGAGAACTAAATATACTGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145175.1-959s1c1
Sequence:CCGGGCAGCAGCAGTACTATCTCAACTCGAGTTGAGATAGTACTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145175.1-965s1c1
Sequence:CCGGGCAGTACTATCTCAAGGTGCACTCGAGTGCACCTTGAGATAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145175.2-315s21c1
Sequence:CCGGCCACCTCAACTACAGCGAGTTCTCGAGAACTCGCTGTAGTTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145175
FAM84A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 84, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-1985s1c1
Sequence:CCGGCGCTTATTGTTCTGAACCCTTCTCGAGAAGGGTTCAGAACAATAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-2123s1c1
Sequence:CCGGCCAGTATATTTAGTTTGGCTTCTCGAGAAGCCAAACTAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145175.1-2117s1c1
Sequence:CCGGCCATAGCCAGTATATTTAGTTCTCGAGAACTAAATATACTGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145175.1-959s1c1
Sequence:CCGGGCAGCAGCAGTACTATCTCAACTCGAGTTGAGATAGTACTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145175.1-965s1c1
Sequence:CCGGGCAGTACTATCTCAAGGTGCACTCGAGTGCACCTTGAGATAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145175.2-315s21c1
Sequence:CCGGCCACCTCAACTACAGCGAGTTCTCGAGAACTCGCTGTAGTTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks