EMAIL THIS PAGE TO A FRIEND

FAM86B1

family with sequence similarity 86, member B1

24 Gene Product Result for
Species: Human FAM86B1(85002)
UniProtKB ID: Q8N7N1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032916 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083537 Rosetta Predictions human pricing
NM_032916 Rosetta Predictions human pricing
NR_003494 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316950 predicted 1027
2 SASI_Hs02_00316951 predicted 1034
3 SASI_Hs02_00316952 predicted 1070
4 SASI_Hs02_00316953 predicted 1027
5 SASI_Hs02_00316954 predicted 1023
6 SASI_Hs02_00316955 predicted 565
7 SASI_Hs02_00316956 predicted 95
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143664 predicted 645
2 SASI_Hs01_00143665 predicted 778
3 SASI_Hs01_00143666 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379293 predicted 782
2 SASI_Hs02_00379294 predicted 760
3 SASI_Hs02_00379295 predicted 773
4 SASI_Hs02_00379296 predicted 811
5 SASI_Hs02_00379297 predicted 753
6 SASI_Hs02_00379298 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032916
FAM86B1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 86, member B1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-373s1c1
Sequence:CCGGGCCTTCATTAACAGACGTGCTCTCGAGAGCACGTCTGTTAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-227s1c1
Sequence:CCGGGCTTTCTCTCAGAACTCATCACTCGAGTGATGAGTTCTGAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-225s1c1
Sequence:CCGGGTGCTTTCTCTCAGAACTCATCTCGAGATGAGTTCTGAGAGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-132s1c1
Sequence:CCGGCTCATCATATTCTGAGCTGCTCTCGAGAGCAGCTCAGAATATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032916.3-575s1c1
Sequence:CCGGGACCAGAAACTGTTTCCCTATCTCGAGATAGGGAAACAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032916
FAM86B1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 86, member B1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-373s1c1
Sequence:CCGGGCCTTCATTAACAGACGTGCTCTCGAGAGCACGTCTGTTAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-227s1c1
Sequence:CCGGGCTTTCTCTCAGAACTCATCACTCGAGTGATGAGTTCTGAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-225s1c1
Sequence:CCGGGTGCTTTCTCTCAGAACTCATCTCGAGATGAGTTCTGAGAGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-132s1c1
Sequence:CCGGCTCATCATATTCTGAGCTGCTCTCGAGAGCAGCTCAGAATATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032916.3-575s1c1
Sequence:CCGGGACCAGAAACTGTTTCCCTATCTCGAGATAGGGAAACAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032916
FAM86B1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 86, member B1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-373s1c1
Sequence:CCGGGCCTTCATTAACAGACGTGCTCTCGAGAGCACGTCTGTTAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-227s1c1
Sequence:CCGGGCTTTCTCTCAGAACTCATCACTCGAGTGATGAGTTCTGAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-225s1c1
Sequence:CCGGGTGCTTTCTCTCAGAACTCATCTCGAGATGAGTTCTGAGAGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032916.3-132s1c1
Sequence:CCGGCTCATCATATTCTGAGCTGCTCTCGAGAGCAGCTCAGAATATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032916.3-575s1c1
Sequence:CCGGGACCAGAAACTGTTTCCCTATCTCGAGATAGGGAAACAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks