EMAIL THIS PAGE TO A FRIEND

FAM86B2

family with sequence similarity 86, member B2

57 Gene Product Result for
Species: Human FAM86B2(653333)
UniProtKB ID: P0C5J1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001715289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001715289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001715289 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715289 Rosetta Predictions human pricing
XM_928336 Rosetta Predictions human pricing
XM_932781 Rosetta Predictions human pricing
XM_932786 Rosetta Predictions human pricing
XM_932791 Rosetta Predictions human pricing
XM_932797 Rosetta Predictions human pricing
XM_932801 Rosetta Predictions human pricing
XM_932804 Rosetta Predictions human pricing
XM_932808 Rosetta Predictions human pricing
XM_932814 Rosetta Predictions human pricing
XM_932818 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402690 predicted 607
2 SASI_Hs02_00402691 predicted 198
3 SASI_Hs02_00402692 predicted 277
4 SASI_Hs02_00402693 predicted 233
5 SASI_Hs02_00402694 predicted 305
6 SASI_Hs02_00402695 predicted 281
7 SASI_Hs02_00402696 predicted 10
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480847 predicted 559
2 SASI_Hs01_00251014 predicted 254
3 SASI_Hs01_00251015 predicted 877
4 SASI_Hs02_00480848 predicted 625
5 SASI_Hs01_00251016 predicted 1090
6 SASI_Hs01_00251017 predicted 1095
7 SASI_Hs01_00251018 predicted 1128
8 SASI_Hs02_00480849 predicted 1079
9 SASI_Hs02_00480850 predicted 1087
10 SASI_Hs02_00480851 predicted 47
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267192 predicted 577
2 SASI_Hs01_00267193 predicted 627
3 SASI_Hs01_00267194 predicted 583
4 SASI_Hs01_00267195 predicted 370
5 SASI_Hs01_00267196 predicted 890
6 SASI_Hs01_00267197 predicted 872
7 SASI_Hs01_00267198 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276860 predicted 598
2 SASI_Hs01_00276861 predicted 604
3 SASI_Hs01_00276862 predicted 602
4 SASI_Hs01_00276863 predicted 605
5 SASI_Hs01_00276864 predicted 607
6 SASI_Hs01_00276865 predicted 596
7 SASI_Hs01_00276866 predicted 400
8 SASI_Hs01_00276867 predicted 412
9 SASI_Hs01_00276868 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287535 predicted 938
2 SASI_Hs01_00287536 predicted 1146
3 SASI_Hs01_00287537 predicted 1151
4 SASI_Hs01_00287538 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251496 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250438 predicted 323
2 SASI_Hs01_00250439 predicted 329
3 SASI_Hs01_00250440 predicted 314
4 SASI_Hs01_00250441 predicted 319
5 SASI_Hs01_00250442 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278013 predicted 840
2 SASI_Hs01_00278014 predicted 838
3 SASI_Hs01_00278015 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292759 predicted 746
2 SASI_Hs01_00292760 predicted 753
3 SASI_Hs01_00292761 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280852 predicted 1395
2 SASI_Hs01_00280853 predicted 1407
3 SASI_Hs01_00280854 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263279 predicted 818
2 SASI_Hs01_00263280 predicted 818
3 SASI_Hs01_00263281 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001715289
FAM86B2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 86, member B2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-89s21c1
Sequence:CCGGATGGAGAGGAGGCTAGGATAACTCGAGTTATCCTAGCCTCCTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-621s21c1
Sequence:CCGGACTCTGAGAGCACAGCCATCACTCGAGTGATGGCTGTGCTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-353s21c1
Sequence:GTACCGGGGAGCTTAGAAGCAAAGTTAACTCGAGTTAACTTTGCTTCTAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-229s21c1
Sequence:CCGGTTTCGAGAGCCGCTTCCTAGTCTCGAGACTAGGAAGCGGCTCTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-274s21c1
Sequence:CCGGCTGGCAGGCAGTAATCGTTCTCTCGAGAGAACGATTACTGCCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001715289
FAM86B2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 86, member B2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-89s21c1
Sequence:CCGGATGGAGAGGAGGCTAGGATAACTCGAGTTATCCTAGCCTCCTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-621s21c1
Sequence:CCGGACTCTGAGAGCACAGCCATCACTCGAGTGATGGCTGTGCTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-353s21c1
Sequence:GTACCGGGGAGCTTAGAAGCAAAGTTAACTCGAGTTAACTTTGCTTCTAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-229s21c1
Sequence:CCGGTTTCGAGAGCCGCTTCCTAGTCTCGAGACTAGGAAGCGGCTCTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-274s21c1
Sequence:CCGGCTGGCAGGCAGTAATCGTTCTCTCGAGAGAACGATTACTGCCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001715289
FAM86B2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 86, member B2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-89s21c1
Sequence:CCGGATGGAGAGGAGGCTAGGATAACTCGAGTTATCCTAGCCTCCTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-621s21c1
Sequence:CCGGACTCTGAGAGCACAGCCATCACTCGAGTGATGGCTGTGCTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-353s21c1
Sequence:GTACCGGGGAGCTTAGAAGCAAAGTTAACTCGAGTTAACTTTGCTTCTAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-229s21c1
Sequence:CCGGTTTCGAGAGCCGCTTCCTAGTCTCGAGACTAGGAAGCGGCTCTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715289.1-274s21c1
Sequence:CCGGCTGGCAGGCAGTAATCGTTCTCTCGAGAGAACGATTACTGCCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks