EMAIL THIS PAGE TO A FRIEND

FAM86C1

family with sequence similarity 86, member C1

23 Gene Product Result for
Synonyms: FAM86C
Species: Human FAM86C1(55199)
UniProtKB ID: Q9NVL1, Q8N5D3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018172 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099653 Rosetta Predictions human pricing
NM_018172 Rosetta Predictions human pricing
NM_152563 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320893 predicted 467
2 SASI_Hs02_00320894 predicted 410
3 SASI_Hs02_00320895 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351427 predicted 485
2 SASI_Hs02_00351428 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366377 predicted 383
2 SASI_Hs02_00366378 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018172
FAM86C1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 86, member C1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018172.2-156s21c1
Sequence:CCGGTCTGAGCTGCTGCGGGATATTCTCGAGAATATCCCGCAGCAGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018172.2-904s21c1
Sequence:CCGGCACACTCGTTTCCTCACAAAGCTCGAGCTTTGTGAGGAAACGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018172.2-435s21c1
Sequence:CCGGTATGCTGGACTGGGATCAGATCTCGAGATCTGATCCCAGTCCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018172.2-597s21c1
Sequence:CCGGTTTATATGGGAAAGCGGATAACTCGAGTTATCCGCTTTCCCATATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-93s1c1
Sequence:CCGGGCAGAGCTTAGAAGCAAAGTTCTCGAGAACTTTGCTTCTAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-252s1c1
Sequence:CCGGCTATTTGCTGACGTGCTGTATCTCGAGATACAGCACGTCAGCAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018172.1-528s1c1
Sequence:CCGGCCAACGGGATTGTGAGAATTACTCGAGTAATTCTCACAATCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-27s1c1
Sequence:CCGGCGAACTCTTGCTGCAGAGTTTCTCGAGAAACTCTGCAGCAAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018172
FAM86C1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 86, member C1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018172.2-156s21c1
Sequence:CCGGTCTGAGCTGCTGCGGGATATTCTCGAGAATATCCCGCAGCAGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018172.2-904s21c1
Sequence:CCGGCACACTCGTTTCCTCACAAAGCTCGAGCTTTGTGAGGAAACGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018172.2-435s21c1
Sequence:CCGGTATGCTGGACTGGGATCAGATCTCGAGATCTGATCCCAGTCCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018172.2-597s21c1
Sequence:CCGGTTTATATGGGAAAGCGGATAACTCGAGTTATCCGCTTTCCCATATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-93s1c1
Sequence:CCGGGCAGAGCTTAGAAGCAAAGTTCTCGAGAACTTTGCTTCTAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-252s1c1
Sequence:CCGGCTATTTGCTGACGTGCTGTATCTCGAGATACAGCACGTCAGCAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018172.1-528s1c1
Sequence:CCGGCCAACGGGATTGTGAGAATTACTCGAGTAATTCTCACAATCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-27s1c1
Sequence:CCGGCGAACTCTTGCTGCAGAGTTTCTCGAGAAACTCTGCAGCAAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018172
FAM86C1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 86, member C1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018172.2-156s21c1
Sequence:CCGGTCTGAGCTGCTGCGGGATATTCTCGAGAATATCCCGCAGCAGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018172.2-904s21c1
Sequence:CCGGCACACTCGTTTCCTCACAAAGCTCGAGCTTTGTGAGGAAACGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018172.2-435s21c1
Sequence:CCGGTATGCTGGACTGGGATCAGATCTCGAGATCTGATCCCAGTCCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018172.2-597s21c1
Sequence:CCGGTTTATATGGGAAAGCGGATAACTCGAGTTATCCGCTTTCCCATATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-93s1c1
Sequence:CCGGGCAGAGCTTAGAAGCAAAGTTCTCGAGAACTTTGCTTCTAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-252s1c1
Sequence:CCGGCTATTTGCTGACGTGCTGTATCTCGAGATACAGCACGTCAGCAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018172.1-528s1c1
Sequence:CCGGCCAACGGGATTGTGAGAATTACTCGAGTAATTCTCACAATCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018172.1-27s1c1
Sequence:CCGGCGAACTCTTGCTGCAGAGTTTCTCGAGAAACTCTGCAGCAAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks