EMAIL THIS PAGE TO A FRIEND

FAM89A

family with sequence similarity 89, member A

66 Gene Product Result for
Synonyms: C1orf153 RP11-423F24.2
UniProtKB ID: Q96GI7
Gene ID:
Mouse(69627) family with sequence similarity 89, member A
Rat(361441) family with sequence similarity 89, member A
Zebrafish(568145) family with sequence similarity 89, member A
cow(616421) family with sequence similarity 89, member A
domestic cat(101091227) family with sequence similarity 89, member A
dog(488974) family with sequence similarity 89, member A
domestic guinea pig(100723007) family with sequence similarity 89, member A
naked mole-rat(101713146) family with sequence similarity 89, member A
sheep(101110902) family with sequence similarity 89, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198552 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136731 MISSION® esiRNA esiRNA human FAM89A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198552 Rosetta Predictions human pricing
NM_001011711 Rosetta Predictions rat pricing
NM_001081120 Rosetta Predictions mouse pricing
XM_134539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118807 predicted 871
2 SASI_Hs01_00118808 predicted 804
3 SASI_Hs02_00372166 predicted 759
4 SASI_Hs01_00118809 predicted 931
5 SASI_Hs01_00118810 predicted 767
6 SASI_Hs01_00118812 predicted 723
7 SASI_Hs01_00118813 predicted 915
8 SASI_Hs01_00118814 predicted 556
9 SASI_Hs01_00118815 predicted 582
10 SASI_Hs02_00372167 predicted 611
11 SASI_Hs01_00118806 predicted 984
12 SASI_Hs01_00118811 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048625 predicted 905
2 SASI_Rn01_00048628 predicted 749
3 SASI_Rn02_00199859 predicted 906
4 SASI_Rn01_00048629 predicted 752
5 SASI_Rn02_00199860 predicted 831
6 SASI_Rn01_00048630 predicted 681
7 SASI_Rn01_00048631 predicted 737
8 SASI_Rn01_00048632 predicted 725
9 SASI_Rn01_00048633 predicted 607
10 SASI_Rn02_00199861 predicted 603
11 SASI_Rn01_00048626 predicted 859
12 SASI_Rn01_00048627 predicted 859
13 SASI_Rn01_00048634 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295381 predicted 650
2 SASI_Mm02_00295382 predicted 847
3 SASI_Mm02_00295383 predicted 721
4 SASI_Mm02_00295384 predicted 832
5 SASI_Mm02_00295385 predicted 824
6 SASI_Mm02_00295386 predicted 703
7 SASI_Mm02_00295387 predicted 624
8 SASI_Mm02_00295388 predicted 773
9 SASI_Mm02_00295389 predicted 850
10 SASI_Mm02_00295390 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208894 predicted 660
2 SASI_Mm01_00208895 predicted 312
3 SASI_Mm01_00208896 predicted 849
4 SASI_Mm01_00208897 predicted 729
5 SASI_Mm01_00208898 predicted 826
6 SASI_Mm01_00208899 predicted 709
7 SASI_Mm01_00208900 predicted 635
8 SASI_Mm01_00208901 predicted 1023
9 SASI_Mm01_00208902 predicted 775
10 SASI_Mm01_00208903 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198552
FAM89A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 89, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-373s1c1
Sequence:CCGGCGAGTCGATTCAGGAGTACAACTCGAGTTGTACTCCTGAATCGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-370s1c1
Sequence:CCGGCTACGAGTCGATTCAGGAGTACTCGAGTACTCCTGAATCGACTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-632s1c1
Sequence:CCGGCGCTGTCATCATTTGCTGCTTCTCGAGAAGCAGCAAATGATGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-374s1c1
Sequence:CCGGGAGTCGATTCAGGAGTACAAGCTCGAGCTTGTACTCCTGAATCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-705s1c1
Sequence:CCGGGCGCTACCAGTTTCATTTGTACTCGAGTACAAATGAAACTGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-982s1c1
Sequence:CCGGGCTTCCAGTTTGGGATGTATTCTCGAGAATACATCCCAAACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-467s1c1
Sequence:CCGGGAATATTTCCAGGAGCAGAACCTCGAGGTTCTGCTCCTGGAAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-961s1c1
Sequence:CCGGCCTCTTTGTGTTAGGGTTCTTCTCGAGAAGAACCCTAACACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-461s1c1
Sequence:CCGGGAGGAGGAATATTTCCAGGAGCTCGAGCTCCTGGAAATATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198552
FAM89A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 89, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-373s1c1
Sequence:CCGGCGAGTCGATTCAGGAGTACAACTCGAGTTGTACTCCTGAATCGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-370s1c1
Sequence:CCGGCTACGAGTCGATTCAGGAGTACTCGAGTACTCCTGAATCGACTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-632s1c1
Sequence:CCGGCGCTGTCATCATTTGCTGCTTCTCGAGAAGCAGCAAATGATGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-374s1c1
Sequence:CCGGGAGTCGATTCAGGAGTACAAGCTCGAGCTTGTACTCCTGAATCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-705s1c1
Sequence:CCGGGCGCTACCAGTTTCATTTGTACTCGAGTACAAATGAAACTGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-982s1c1
Sequence:CCGGGCTTCCAGTTTGGGATGTATTCTCGAGAATACATCCCAAACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-467s1c1
Sequence:CCGGGAATATTTCCAGGAGCAGAACCTCGAGGTTCTGCTCCTGGAAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-961s1c1
Sequence:CCGGCCTCTTTGTGTTAGGGTTCTTCTCGAGAAGAACCCTAACACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-461s1c1
Sequence:CCGGGAGGAGGAATATTTCCAGGAGCTCGAGCTCCTGGAAATATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198552
FAM89A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 89, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-373s1c1
Sequence:CCGGCGAGTCGATTCAGGAGTACAACTCGAGTTGTACTCCTGAATCGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-370s1c1
Sequence:CCGGCTACGAGTCGATTCAGGAGTACTCGAGTACTCCTGAATCGACTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-632s1c1
Sequence:CCGGCGCTGTCATCATTTGCTGCTTCTCGAGAAGCAGCAAATGATGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-374s1c1
Sequence:CCGGGAGTCGATTCAGGAGTACAAGCTCGAGCTTGTACTCCTGAATCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-705s1c1
Sequence:CCGGGCGCTACCAGTTTCATTTGTACTCGAGTACAAATGAAACTGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-982s1c1
Sequence:CCGGGCTTCCAGTTTGGGATGTATTCTCGAGAATACATCCCAAACTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-467s1c1
Sequence:CCGGGAATATTTCCAGGAGCAGAACCTCGAGGTTCTGCTCCTGGAAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198552.1-961s1c1
Sequence:CCGGCCTCTTTGTGTTAGGGTTCTTCTCGAGAAGAACCCTAACACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198552.1-461s1c1
Sequence:CCGGGAGGAGGAATATTTCCAGGAGCTCGAGCTCCTGGAAATATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks