EMAIL THIS PAGE TO A FRIEND

FAM89B

family with sequence similarity 89, member B

106 Gene Product Result for
Synonyms: MTVR1
UniProtKB ID: Q8N5H3, E9PB01, E9PL72, Q6PJ27
Gene ID:
Mouse(17826) family with sequence similarity 89, member B
Rat(309170) family with sequence similarity 89, member B
sheep(101123249) family with sequence similarity 89, member B
naked mole-rat(101720192) family with sequence similarity 89, member B
domestic guinea pig(100729718) family with sequence similarity 89, member B
dog(483735) family with sequence similarity 89, member B
domestic cat(101086676) family with sequence similarity 89, member B
cow(511465) family with sequence similarity 89, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152832 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098784 Rosetta Predictions human pricing
NM_001098785 Rosetta Predictions human pricing
NM_152832 Rosetta Predictions human pricing
NM_001015013 Rosetta Predictions rat pricing
NM_023166 Rosetta Predictions mouse pricing
NM_181452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319799 predicted 1205
2 SASI_Hs02_00319800 predicted 1030
3 SASI_Hs02_00319801 predicted 1022
4 SASI_Hs02_00319802 predicted 1045
5 SASI_Hs02_00319803 predicted 1036
6 SASI_Hs02_00319804 predicted 1084
7 SASI_Hs02_00319805 predicted 1016
8 SASI_Hs02_00319806 predicted 1118
9 SASI_Hs02_00319807 predicted 1179
10 SASI_Hs02_00319808 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319809 predicted 1197
2 SASI_Hs02_00319810 predicted 1022
3 SASI_Hs02_00319811 predicted 1012
4 SASI_Hs02_00319812 predicted 1034
5 SASI_Hs02_00319813 predicted 1024
6 SASI_Hs02_00319814 predicted 1073
7 SASI_Hs02_00319815 predicted 1004
8 SASI_Hs02_00319816 predicted 1112
9 SASI_Hs02_00319817 predicted 1168
10 SASI_Hs02_00319818 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366750 predicted 1161
2 SASI_Hs01_00168302 predicted 981
3 SASI_Hs01_00168304 predicted 977
4 SASI_Hs01_00168305 predicted 991
5 SASI_Hs01_00168306 predicted 987
6 SASI_Hs01_00168307 predicted 1035
7 SASI_Hs02_00366751 predicted 967
8 SASI_Hs02_00366752 predicted 1068
9 SASI_Hs02_00366753 predicted 1130
10 SASI_Hs02_00366754 predicted 1157
11 SASI_Hs01_00168303 predicted 807
12 SASI_Hs01_00168308 predicted 1067
13 SASI_Hs01_00168309 predicted 998
14 SASI_Hs01_00168310 predicted 1094
15 SASI_Hs01_00168311 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202001 predicted 852
2 SASI_Rn02_00202002 predicted 805
3 SASI_Rn02_00202003 predicted 628
4 SASI_Rn02_00202004 predicted 475
5 SASI_Rn02_00202005 predicted 777
6 SASI_Rn02_00202006 predicted 451
7 SASI_Rn02_00202007 predicted 864
8 SASI_Rn02_00202008 predicted 918
9 SASI_Rn02_00202009 predicted 924
10 SASI_Rn02_00202010 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187462 predicted 753
2 SASI_Mm01_00187463 predicted 914
3 SASI_Mm01_00187464 predicted 596
4 SASI_Mm01_00187466 predicted 836
5 SASI_Mm01_00187467 predicted 726
6 SASI_Mm02_00326887 predicted 777
7 SASI_Mm01_00187468 predicted 697
8 SASI_Mm01_00187469 predicted 820
9 SASI_Mm01_00187470 predicted 797
10 SASI_Mm01_00187471 predicted 797
11 SASI_Mm01_00187465 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090352 predicted 810
2 SASI_Mm01_00090353 predicted 975
3 SASI_Mm01_00090354 predicted 657
4 SASI_Mm01_00090356 predicted 887
5 SASI_Mm01_00090357 predicted 772
6 SASI_Mm02_00349787 predicted 827
7 SASI_Mm01_00090358 predicted 756
8 SASI_Mm01_00090359 predicted 881
9 SASI_Mm01_00090360 predicted 851
10 SASI_Mm01_00090361 predicted 850
11 SASI_Mm01_00090355 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181452
VALIDATED
FAM89B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 89, member B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-741s1c1
Sequence:CCGGCTTCAGCAAGTCCTTAGTCTACTCGAGTAGACTAAGGACTTGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-371s1c1
Sequence:CCGGGTTAACCTCGACTCTGCACTACTCGAGTAGTGCAGAGTCGAGGTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-659s1c1
Sequence:CCGGTGGTTGCAGGATGCTTTCCAACTCGAGTTGGAAAGCATCCTGCAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-479s1c1
Sequence:CCGGGACTACAAGCATCTGTGCCAACTCGAGTTGGCACAGATGCTTGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-327s1c1
Sequence:CCGGCTGGATCTGCTAACTCAGGTTCTCGAGAACCTGAGTTAGCAGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-203s21c1
Sequence:CCGGAGCGGCCTTCTTAACGCTAGTCTCGAGACTAGCGTTAAGAAGGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-741s21c1
Sequence:CCGGCTTCAGCAAGTCCTTAGTCTACTCGAGTAGACTAAGGACTTGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-327s21c1
Sequence:CCGGCTGGATCTGCTAACTCAGGTTCTCGAGAACCTGAGTTAGCAGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-659s21c1
Sequence:CCGGTGGTTGCAGGATGCTTTCCAACTCGAGTTGGAAAGCATCCTGCAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-371s21c1
Sequence:CCGGGTTAACCTCGACTCTGCACTACTCGAGTAGTGCAGAGTCGAGGTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181452
VALIDATED
FAM89B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 89, member B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-741s1c1
Sequence:CCGGCTTCAGCAAGTCCTTAGTCTACTCGAGTAGACTAAGGACTTGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-371s1c1
Sequence:CCGGGTTAACCTCGACTCTGCACTACTCGAGTAGTGCAGAGTCGAGGTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-659s1c1
Sequence:CCGGTGGTTGCAGGATGCTTTCCAACTCGAGTTGGAAAGCATCCTGCAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-479s1c1
Sequence:CCGGGACTACAAGCATCTGTGCCAACTCGAGTTGGCACAGATGCTTGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-327s1c1
Sequence:CCGGCTGGATCTGCTAACTCAGGTTCTCGAGAACCTGAGTTAGCAGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-203s21c1
Sequence:CCGGAGCGGCCTTCTTAACGCTAGTCTCGAGACTAGCGTTAAGAAGGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-741s21c1
Sequence:CCGGCTTCAGCAAGTCCTTAGTCTACTCGAGTAGACTAAGGACTTGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-327s21c1
Sequence:CCGGCTGGATCTGCTAACTCAGGTTCTCGAGAACCTGAGTTAGCAGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-659s21c1
Sequence:CCGGTGGTTGCAGGATGCTTTCCAACTCGAGTTGGAAAGCATCCTGCAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-371s21c1
Sequence:CCGGGTTAACCTCGACTCTGCACTACTCGAGTAGTGCAGAGTCGAGGTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181452
VALIDATED
FAM89B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 89, member B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-741s1c1
Sequence:CCGGCTTCAGCAAGTCCTTAGTCTACTCGAGTAGACTAAGGACTTGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-371s1c1
Sequence:CCGGGTTAACCTCGACTCTGCACTACTCGAGTAGTGCAGAGTCGAGGTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-659s1c1
Sequence:CCGGTGGTTGCAGGATGCTTTCCAACTCGAGTTGGAAAGCATCCTGCAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-479s1c1
Sequence:CCGGGACTACAAGCATCTGTGCCAACTCGAGTTGGCACAGATGCTTGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181452.1-327s1c1
Sequence:CCGGCTGGATCTGCTAACTCAGGTTCTCGAGAACCTGAGTTAGCAGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-203s21c1
Sequence:CCGGAGCGGCCTTCTTAACGCTAGTCTCGAGACTAGCGTTAAGAAGGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-741s21c1
Sequence:CCGGCTTCAGCAAGTCCTTAGTCTACTCGAGTAGACTAAGGACTTGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-327s21c1
Sequence:CCGGCTGGATCTGCTAACTCAGGTTCTCGAGAACCTGAGTTAGCAGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-659s21c1
Sequence:CCGGTGGTTGCAGGATGCTTTCCAACTCGAGTTGGAAAGCATCCTGCAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181452.1-371s21c1
Sequence:CCGGGTTAACCTCGACTCTGCACTACTCGAGTAGTGCAGAGTCGAGGTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152832
FAM89B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 89, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-651s1c1
Sequence:CCGGGACTACAAACACCTGTGCCAACTCGAGTTGGCACAGGTGTTTGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-704s1c1
Sequence:CCGGCCTCCATTCGGACAGCTCCTACTCGAGTAGGAGCTGTCCGAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-806s1c1
Sequence:CCGGCCAGACGCACAATGCCCGTGACTCGAGTCACGGGCATTGTGCGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-576s1c1
Sequence:CCGGCGTCCTGTCAACCTCGACTCACTCGAGTGAGTCGAGGTTGACAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-635s1c1
Sequence:CCGGGTACGAGTCAATCCAGGACTACTCGAGTAGTCCTGGATTGACTCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152832.2-1049s21c1
Sequence:CCGGAGGGTACAGCCTCTGCTCATGCTCGAGCATGAGCAGAGGCTGTACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152832.2-977s21c1
Sequence:CCGGTGTATTCCTCAGAGGCGAAACCTCGAGGTTTCGCCTCTGAGGAATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152832.2-653s21c1
Sequence:CCGGTGTGCCAAGACCTGAGCTTCTCTCGAGAGAAGCTCAGGTCTTGGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152832
FAM89B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 89, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-651s1c1
Sequence:CCGGGACTACAAACACCTGTGCCAACTCGAGTTGGCACAGGTGTTTGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-704s1c1
Sequence:CCGGCCTCCATTCGGACAGCTCCTACTCGAGTAGGAGCTGTCCGAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-806s1c1
Sequence:CCGGCCAGACGCACAATGCCCGTGACTCGAGTCACGGGCATTGTGCGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-576s1c1
Sequence:CCGGCGTCCTGTCAACCTCGACTCACTCGAGTGAGTCGAGGTTGACAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-635s1c1
Sequence:CCGGGTACGAGTCAATCCAGGACTACTCGAGTAGTCCTGGATTGACTCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152832.2-1049s21c1
Sequence:CCGGAGGGTACAGCCTCTGCTCATGCTCGAGCATGAGCAGAGGCTGTACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152832.2-977s21c1
Sequence:CCGGTGTATTCCTCAGAGGCGAAACCTCGAGGTTTCGCCTCTGAGGAATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152832.2-653s21c1
Sequence:CCGGTGTGCCAAGACCTGAGCTTCTCTCGAGAGAAGCTCAGGTCTTGGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152832
FAM89B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 89, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-651s1c1
Sequence:CCGGGACTACAAACACCTGTGCCAACTCGAGTTGGCACAGGTGTTTGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-704s1c1
Sequence:CCGGCCTCCATTCGGACAGCTCCTACTCGAGTAGGAGCTGTCCGAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-806s1c1
Sequence:CCGGCCAGACGCACAATGCCCGTGACTCGAGTCACGGGCATTGTGCGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-576s1c1
Sequence:CCGGCGTCCTGTCAACCTCGACTCACTCGAGTGAGTCGAGGTTGACAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152832.1-635s1c1
Sequence:CCGGGTACGAGTCAATCCAGGACTACTCGAGTAGTCCTGGATTGACTCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152832.2-1049s21c1
Sequence:CCGGAGGGTACAGCCTCTGCTCATGCTCGAGCATGAGCAGAGGCTGTACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152832.2-977s21c1
Sequence:CCGGTGTATTCCTCAGAGGCGAAACCTCGAGGTTTCGCCTCTGAGGAATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152832.2-653s21c1
Sequence:CCGGTGTGCCAAGACCTGAGCTTCTCTCGAGAGAAGCTCAGGTCTTGGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)