EMAIL THIS PAGE TO A FRIEND

FAM8A1

family with sequence similarity 8, member A1

87 Gene Product Result for
Synonyms: AHCP
UniProtKB ID: Q9UBU6, B2R725
Gene ID:
Rat(291031) family with sequence similarity 8, member A1
Zebrafish(548347) family with sequence similarity 8, member A1
dog(610483) family with sequence similarity 8, member A1
chicken(771369) family with sequence similarity 8, member A1
cow(511911) family with sequence similarity 8, member A1
domestic cat(101091281) family with sequence similarity 8, member A1
domestic guinea pig(100720968) family with sequence similarity 8, member A1
naked mole-rat(101707702) family with sequence similarity 8, member A1
sheep(101112268) family with sequence similarity 8, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016255 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106151 MISSION® esiRNA esiRNA human FAM8A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016255 Rosetta Predictions human pricing
XM_001058608 Rosetta Predictions rat pricing
XM_214446 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215957 predicted 974
2 SASI_Hs01_00215958 predicted 892
3 SASI_Hs01_00215959 predicted 871
4 SASI_Hs01_00215961 predicted 843
5 SASI_Hs02_00349137 predicted 977
6 SASI_Hs01_00215962 predicted 1065
7 SASI_Hs01_00215963 predicted 759
8 SASI_Hs01_00215964 predicted 1242
9 SASI_Hs01_00215965 predicted 965
10 SASI_Hs01_00215966 predicted 1362
11 SASI_Hs01_00215960 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290324 predicted 1437
2 SASI_Rn02_00290325 predicted 1006
3 SASI_Rn02_00290326 predicted 1279
4 SASI_Rn02_00290327 predicted 974
5 SASI_Rn02_00290328 predicted 1436
6 SASI_Rn02_00290329 predicted 1149
7 SASI_Rn02_00290330 predicted 955
8 SASI_Rn02_00290331 predicted 1279
9 SASI_Rn02_00290332 predicted 948
10 SASI_Rn02_00290333 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375285 predicted 216
2 SASI_Rn02_00375286 predicted 442
3 SASI_Rn02_00375287 predicted 1962
4 SASI_Rn02_00375288 predicted 1526
5 SASI_Rn02_00375289 predicted 1496
6 SASI_Rn02_00375290 predicted 1666
7 SASI_Rn02_00375291 predicted 229
8 SASI_Rn02_00375292 predicted 1480
9 SASI_Rn02_00375293 predicted 1467
10 SASI_Rn02_00375294 predicted 1849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016255
VALIDATED
FAM8A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 8, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-916s21c1
Sequence:CCGGGCAACCATTGTCTTAAGCATTCTCGAGAATGCTTAAGACAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-1304s21c1
Sequence:CCGGATCGAACAGCTTATGACATTGCTCGAGCAATGTCATAAGCTGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016255.2-1044s21c1
Sequence:CCGGGGCACTTATATACAGATTATTCTCGAGAATAATCTGTATATAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-1150s21c1
Sequence:CCGGTGTGATACATCAGTGCTTATTCTCGAGAATAAGCACTGATGTATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-4563s21c1
Sequence:CCGGCCTGGATAAAGTTCCTCATTTCTCGAGAAATGAGGAACTTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-1244s1c1
Sequence:CCGGGCTTATGACATTGTAGCAGGACTCGAGTCCTGCTACAATGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-4490s1c1
Sequence:CCGGCCTGGATAAAGTTCCTCATTTCTCGAGAAATGAGGAACTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016255.1-2597s1c1
Sequence:CCGGGCTGAGATATACCTGTACTATCTCGAGATAGTACAGGTATATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-848s1c1
Sequence:CCGGGCAACCATTGTCTTAAGCATTCTCGAGAATGCTTAAGACAATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-4489s1c1
Sequence:CCGGGCCTGGATAAAGTTCCTCATTCTCGAGAATGAGGAACTTTATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016255
VALIDATED
FAM8A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 8, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-916s21c1
Sequence:CCGGGCAACCATTGTCTTAAGCATTCTCGAGAATGCTTAAGACAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-1304s21c1
Sequence:CCGGATCGAACAGCTTATGACATTGCTCGAGCAATGTCATAAGCTGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016255.2-1044s21c1
Sequence:CCGGGGCACTTATATACAGATTATTCTCGAGAATAATCTGTATATAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-1150s21c1
Sequence:CCGGTGTGATACATCAGTGCTTATTCTCGAGAATAAGCACTGATGTATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-4563s21c1
Sequence:CCGGCCTGGATAAAGTTCCTCATTTCTCGAGAAATGAGGAACTTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-1244s1c1
Sequence:CCGGGCTTATGACATTGTAGCAGGACTCGAGTCCTGCTACAATGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-4490s1c1
Sequence:CCGGCCTGGATAAAGTTCCTCATTTCTCGAGAAATGAGGAACTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016255.1-2597s1c1
Sequence:CCGGGCTGAGATATACCTGTACTATCTCGAGATAGTACAGGTATATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-848s1c1
Sequence:CCGGGCAACCATTGTCTTAAGCATTCTCGAGAATGCTTAAGACAATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-4489s1c1
Sequence:CCGGGCCTGGATAAAGTTCCTCATTCTCGAGAATGAGGAACTTTATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016255
VALIDATED
FAM8A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 8, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-916s21c1
Sequence:CCGGGCAACCATTGTCTTAAGCATTCTCGAGAATGCTTAAGACAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-1304s21c1
Sequence:CCGGATCGAACAGCTTATGACATTGCTCGAGCAATGTCATAAGCTGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016255.2-1044s21c1
Sequence:CCGGGGCACTTATATACAGATTATTCTCGAGAATAATCTGTATATAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-1150s21c1
Sequence:CCGGTGTGATACATCAGTGCTTATTCTCGAGAATAAGCACTGATGTATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016255.2-4563s21c1
Sequence:CCGGCCTGGATAAAGTTCCTCATTTCTCGAGAAATGAGGAACTTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-1244s1c1
Sequence:CCGGGCTTATGACATTGTAGCAGGACTCGAGTCCTGCTACAATGTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-4490s1c1
Sequence:CCGGCCTGGATAAAGTTCCTCATTTCTCGAGAAATGAGGAACTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016255.1-2597s1c1
Sequence:CCGGGCTGAGATATACCTGTACTATCTCGAGATAGTACAGGTATATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-848s1c1
Sequence:CCGGGCAACCATTGTCTTAAGCATTCTCGAGAATGCTTAAGACAATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016255.1-4489s1c1
Sequence:CCGGGCCTGGATAAAGTTCCTCATTCTCGAGAATGAGGAACTTTATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks