EMAIL THIS PAGE TO A FRIEND

FAM90A1

family with sequence similarity 90, member A1

52 Gene Product Result for
UniProtKB ID: Q86YD7, D3DUU9, Q9NVZ6
Gene ID:
Human(55138) Summary: FAM90A1 belongs to subfamily I of the primate-specific FAM90A gene family, which originated from multiple duplications and rearrangements (Bosch et al., 2007 [PubMed 17684299]
Rat(100362477) family with sequence similarity 90, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018088 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018088 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068004 predicted 2150
2 SASI_Hs01_00068005 predicted 753
3 SASI_Hs01_00068006 predicted 2146
4 SASI_Hs02_00351262 predicted 2380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018088
FAM90A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 90, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-727s1c1
Sequence:CCGGGAAGGCTCTCCTCCACATATTCTCGAGAATATGTGGAGGAGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-1620s1c1
Sequence:CCGGCCTCATTTCACTCTCCTGAGACTCGAGTCTCAGGAGAGTGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-795s1c1
Sequence:CCGGCGGAATCTTCTGATTATCTGACTCGAGTCAGATAATCAGAAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018088.2-2123s1c1
Sequence:CCGGGCTCTCTAGACGACTGAATAACTCGAGTTATTCAGTCGTCTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-1621s1c1
Sequence:CCGGCTCATTTCACTCTCCTGAGAACTCGAGTTCTCAGGAGAGTGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018088.2-789s1c1
Sequence:CCGGGATCCACGGAATCTTCTGATTCTCGAGAATCAGAAGATTCCGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018088.3-2122s21c1
Sequence:CCGGAGGGACTCTGCCACGTTGAATCTCGAGATTCAACGTGGCAGAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-1058s21c1
Sequence:CCGGGATCGCTCAGCTACCGAAATGCTCGAGCATTTCGGTAGCTGAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-1728s21c1
Sequence:CCGGAGCCTCTCAGAGTGCTCTTTCCTCGAGGAAAGAGCACTCTGAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-759s21c1
Sequence:CCGGCCCTGGTTCCACCGAACTTTGCTCGAGCAAAGTTCGGTGGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018088
FAM90A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 90, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-727s1c1
Sequence:CCGGGAAGGCTCTCCTCCACATATTCTCGAGAATATGTGGAGGAGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-1620s1c1
Sequence:CCGGCCTCATTTCACTCTCCTGAGACTCGAGTCTCAGGAGAGTGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-795s1c1
Sequence:CCGGCGGAATCTTCTGATTATCTGACTCGAGTCAGATAATCAGAAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018088.2-2123s1c1
Sequence:CCGGGCTCTCTAGACGACTGAATAACTCGAGTTATTCAGTCGTCTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-1621s1c1
Sequence:CCGGCTCATTTCACTCTCCTGAGAACTCGAGTTCTCAGGAGAGTGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018088.2-789s1c1
Sequence:CCGGGATCCACGGAATCTTCTGATTCTCGAGAATCAGAAGATTCCGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018088.3-2122s21c1
Sequence:CCGGAGGGACTCTGCCACGTTGAATCTCGAGATTCAACGTGGCAGAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-1058s21c1
Sequence:CCGGGATCGCTCAGCTACCGAAATGCTCGAGCATTTCGGTAGCTGAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-1728s21c1
Sequence:CCGGAGCCTCTCAGAGTGCTCTTTCCTCGAGGAAAGAGCACTCTGAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-759s21c1
Sequence:CCGGCCCTGGTTCCACCGAACTTTGCTCGAGCAAAGTTCGGTGGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018088
FAM90A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 90, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-727s1c1
Sequence:CCGGGAAGGCTCTCCTCCACATATTCTCGAGAATATGTGGAGGAGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-1620s1c1
Sequence:CCGGCCTCATTTCACTCTCCTGAGACTCGAGTCTCAGGAGAGTGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-795s1c1
Sequence:CCGGCGGAATCTTCTGATTATCTGACTCGAGTCAGATAATCAGAAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018088.2-2123s1c1
Sequence:CCGGGCTCTCTAGACGACTGAATAACTCGAGTTATTCAGTCGTCTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018088.2-1621s1c1
Sequence:CCGGCTCATTTCACTCTCCTGAGAACTCGAGTTCTCAGGAGAGTGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018088.2-789s1c1
Sequence:CCGGGATCCACGGAATCTTCTGATTCTCGAGAATCAGAAGATTCCGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018088.3-2122s21c1
Sequence:CCGGAGGGACTCTGCCACGTTGAATCTCGAGATTCAACGTGGCAGAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-1058s21c1
Sequence:CCGGGATCGCTCAGCTACCGAAATGCTCGAGCATTTCGGTAGCTGAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-1728s21c1
Sequence:CCGGAGCCTCTCAGAGTGCTCTTTCCTCGAGGAAAGAGCACTCTGAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018088.3-759s21c1
Sequence:CCGGCCCTGGTTCCACCGAACTTTGCTCGAGCAAAGTTCGGTGGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks