EMAIL THIS PAGE TO A FRIEND

FAM90A7P

family with sequence similarity 90, member A7, pseudogene

5 Gene Product Result for
Synonyms: FAM90A7
Species: Human FAM90A7P(441317)
UniProtKB ID: A6NKC0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136572 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_496948 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480059 predicted 404
2 SASI_Hs02_00480060 predicted 407
3 SASI_Hs02_00480061 predicted 1884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136572
FAM90A7P MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 90, member A7, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-498s21c1
Sequence:CCGGTGATCGCTCAGCTACCGAAATCTCGAGATTTCGGTAGCTGAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136572.1-1691s21c1
Sequence:CCGGACTTCCGCTGGGACGTCAATACTCGAGTATTGACGTCCCAGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-408s21c1
Sequence:CCGGCACGGAATCTTCCGAGCATCTCTCGAGAGATGCTCGGAAGATTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-1363s21c1
Sequence:CCGGTCCTCAGAGGACAGCGATTCTCTCGAGAGAATCGCTGTCCTCTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-452s21c1
Sequence:CCGGCGGTCCACACAACCAGTAAGACTCGAGTCTTACTGGTTGTGTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136572
FAM90A7P MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 90, member A7, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-498s21c1
Sequence:CCGGTGATCGCTCAGCTACCGAAATCTCGAGATTTCGGTAGCTGAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136572.1-1691s21c1
Sequence:CCGGACTTCCGCTGGGACGTCAATACTCGAGTATTGACGTCCCAGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-408s21c1
Sequence:CCGGCACGGAATCTTCCGAGCATCTCTCGAGAGATGCTCGGAAGATTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-1363s21c1
Sequence:CCGGTCCTCAGAGGACAGCGATTCTCTCGAGAGAATCGCTGTCCTCTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-452s21c1
Sequence:CCGGCGGTCCACACAACCAGTAAGACTCGAGTCTTACTGGTTGTGTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136572
FAM90A7P MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 90, member A7, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-498s21c1
Sequence:CCGGTGATCGCTCAGCTACCGAAATCTCGAGATTTCGGTAGCTGAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136572.1-1691s21c1
Sequence:CCGGACTTCCGCTGGGACGTCAATACTCGAGTATTGACGTCCCAGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-408s21c1
Sequence:CCGGCACGGAATCTTCCGAGCATCTCTCGAGAGATGCTCGGAAGATTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-1363s21c1
Sequence:CCGGTCCTCAGAGGACAGCGATTCTCTCGAGAGAATCGCTGTCCTCTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136572.1-452s21c1
Sequence:CCGGCGGTCCACACAACCAGTAAGACTCGAGTCTTACTGGTTGTGTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks