EMAIL THIS PAGE TO A FRIEND

FAM91A1

family with sequence similarity 91, member A1

190 Gene Product Result for
UniProtKB ID: Q658Y4, B6YY23, Q658T5, Q8TE89
Gene ID:
Rat(689997) family with sequence similarity 91, member A1
Zebrafish(393413) family with sequence similarity 91, member A1
chicken(770621) family with sequence similarity 91, member A1
domestic cat(101083908) family with sequence similarity 91, member A1
cow(507013) family with sequence similarity 91, member A1
dog(482035) family with sequence similarity 91, member A1
domestic guinea pig(100725908) family with sequence similarity 91, member A1
naked mole-rat(101717242) family with sequence similarity 91, member A1
sheep(101103162) family with sequence similarity 91, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144963 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146801 MISSION® esiRNA esiRNA human FAM91A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144963 Rosetta Predictions human pricing
NM_001127578 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364746 predicted 2131
2 SASI_Hs01_00019593 predicted 1110
3 SASI_Hs01_00019594 predicted 1517
4 SASI_Hs01_00019595 predicted 2206
5 SASI_Hs01_00019596 predicted 1812
6 SASI_Hs01_00019597 predicted 1394
7 SASI_Hs01_00019599 predicted 290
8 SASI_Hs01_00019600 predicted 1758
9 SASI_Hs01_00019601 predicted 308
10 SASI_Hs02_00364747 predicted 353
11 SASI_Hs01_00019592 predicted 1961
12 SASI_Hs01_00019598 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254510 predicted 2365
2 SASI_Rn02_00254511 predicted 890
3 SASI_Rn02_00254512 predicted 1716
4 SASI_Rn02_00254513 predicted 619
5 SASI_Rn02_00254514 predicted 1892
6 SASI_Rn02_00254515 predicted 489
7 SASI_Rn02_00254516 predicted 1985
8 SASI_Rn02_00254517 predicted 1026
9 SASI_Rn02_00254518 predicted 2199
10 SASI_Rn02_00254519 predicted 2052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144963
VALIDATED
FAM91A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 91, member A1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1223s21c1
Sequence:CCGGGCCTTCTTAATGATGGGAAATCTCGAGATTTCCCATCATTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-2115s21c1
Sequence:CCGGGCTCAGATGTAAATGGGAGTACTCGAGTACTCCCATTTACATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1212s21c1
Sequence:CCGGCCACTCTTACTGCCTTCTTAACTCGAGTTAAGAAGGCAGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1310s21c1
Sequence:CCGGCTGGACAGCTTTCTTATAGAACTCGAGTTCTATAAGAAAGCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1941s21c1
Sequence:CCGGGAGAGTTCACTCGTGTCAATACTCGAGTATTGACACGAGTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-363s1c1
Sequence:CCGGGCACACAAATGTTGCAGAGCTCTCGAGAGCTCTGCAACATTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-397s1c1
Sequence:CCGGGAGATTGACTTATCCCTGGTTCTCGAGAACCAGGGATAAGTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-1625s1c1
Sequence:CCGGGCTCAGATGTAAATGGGAGTACTCGAGTACTCCCATTTACATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-820s1c1
Sequence:CCGGCTGGACAGCTTTCTTATAGAACTCGAGTTCTATAAGAAAGCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-778s1c1
Sequence:CCGGGCAGTCACAATGTTTGAAGTACTCGAGTACTTCAAACATTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-733s1c1
Sequence:CCGGGCCTTCTTAATGATGGGAAATCTCGAGATTTCCCATCATTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144963.1-1772s1c1
Sequence:CCGGCCGAATTAAACCGGAAAGTTTCTCGAGAAACTTTCCGGTTTAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-381s1c1
Sequence:CCGGGCTTGCAAATGTCCTTGAGATCTCGAGATCTCAAGGACATTTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-1451s1c1
Sequence:CCGGGAGAGTTCACTCGTGTCAATACTCGAGTATTGACACGAGTGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-722s1c1
Sequence:CCGGCCACTCTTACTGCCTTCTTAACTCGAGTTAAGAAGGCAGTAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144963
VALIDATED
FAM91A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 91, member A1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1223s21c1
Sequence:CCGGGCCTTCTTAATGATGGGAAATCTCGAGATTTCCCATCATTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-2115s21c1
Sequence:CCGGGCTCAGATGTAAATGGGAGTACTCGAGTACTCCCATTTACATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1212s21c1
Sequence:CCGGCCACTCTTACTGCCTTCTTAACTCGAGTTAAGAAGGCAGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1310s21c1
Sequence:CCGGCTGGACAGCTTTCTTATAGAACTCGAGTTCTATAAGAAAGCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1941s21c1
Sequence:CCGGGAGAGTTCACTCGTGTCAATACTCGAGTATTGACACGAGTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-363s1c1
Sequence:CCGGGCACACAAATGTTGCAGAGCTCTCGAGAGCTCTGCAACATTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-397s1c1
Sequence:CCGGGAGATTGACTTATCCCTGGTTCTCGAGAACCAGGGATAAGTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-1625s1c1
Sequence:CCGGGCTCAGATGTAAATGGGAGTACTCGAGTACTCCCATTTACATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-820s1c1
Sequence:CCGGCTGGACAGCTTTCTTATAGAACTCGAGTTCTATAAGAAAGCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-778s1c1
Sequence:CCGGGCAGTCACAATGTTTGAAGTACTCGAGTACTTCAAACATTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-733s1c1
Sequence:CCGGGCCTTCTTAATGATGGGAAATCTCGAGATTTCCCATCATTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144963.1-1772s1c1
Sequence:CCGGCCGAATTAAACCGGAAAGTTTCTCGAGAAACTTTCCGGTTTAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-381s1c1
Sequence:CCGGGCTTGCAAATGTCCTTGAGATCTCGAGATCTCAAGGACATTTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-1451s1c1
Sequence:CCGGGAGAGTTCACTCGTGTCAATACTCGAGTATTGACACGAGTGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-722s1c1
Sequence:CCGGCCACTCTTACTGCCTTCTTAACTCGAGTTAAGAAGGCAGTAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144963
VALIDATED
FAM91A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 91, member A1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1223s21c1
Sequence:CCGGGCCTTCTTAATGATGGGAAATCTCGAGATTTCCCATCATTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-2115s21c1
Sequence:CCGGGCTCAGATGTAAATGGGAGTACTCGAGTACTCCCATTTACATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1212s21c1
Sequence:CCGGCCACTCTTACTGCCTTCTTAACTCGAGTTAAGAAGGCAGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1310s21c1
Sequence:CCGGCTGGACAGCTTTCTTATAGAACTCGAGTTCTATAAGAAAGCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144963.2-1941s21c1
Sequence:CCGGGAGAGTTCACTCGTGTCAATACTCGAGTATTGACACGAGTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-363s1c1
Sequence:CCGGGCACACAAATGTTGCAGAGCTCTCGAGAGCTCTGCAACATTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-397s1c1
Sequence:CCGGGAGATTGACTTATCCCTGGTTCTCGAGAACCAGGGATAAGTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-1625s1c1
Sequence:CCGGGCTCAGATGTAAATGGGAGTACTCGAGTACTCCCATTTACATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-820s1c1
Sequence:CCGGCTGGACAGCTTTCTTATAGAACTCGAGTTCTATAAGAAAGCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-778s1c1
Sequence:CCGGGCAGTCACAATGTTTGAAGTACTCGAGTACTTCAAACATTGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-733s1c1
Sequence:CCGGGCCTTCTTAATGATGGGAAATCTCGAGATTTCCCATCATTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144963.1-1772s1c1
Sequence:CCGGCCGAATTAAACCGGAAAGTTTCTCGAGAAACTTTCCGGTTTAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-381s1c1
Sequence:CCGGGCTTGCAAATGTCCTTGAGATCTCGAGATCTCAAGGACATTTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-1451s1c1
Sequence:CCGGGAGAGTTCACTCGTGTCAATACTCGAGTATTGACACGAGTGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144963.1-722s1c1
Sequence:CCGGCCACTCTTACTGCCTTCTTAACTCGAGTTAAGAAGGCAGTAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks