EMAIL THIS PAGE TO A FRIEND

FAM92A1

family with sequence similarity 92, member A1

103 Gene Product Result for
UniProtKB ID: A1XBS5, A1XBS4, Q32ND3, Q6AHW7, Q8N8R1, Q96L09
Gene ID:
Rat(297903) family with sequence similarity 92, member A1
sheep(101112577) family with sequence similarity 92, member A1
naked mole-rat(101723238) family with sequence similarity 92, member A1
domestic guinea pig(100720584) family with sequence similarity 92, member A1
Zebrafish(445210) family with sequence similarity 92, member A1
chicken(428371) family with sequence similarity 92, member A1
cow(614070) family with sequence similarity 92, member A1
domestic cat(101088813) family with sequence similarity 92, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145269 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_926337 Rosetta Predictions human pricing
XM_931181 Rosetta Predictions human pricing
XM_931185 Rosetta Predictions human pricing
XM_931194 Rosetta Predictions human pricing
XM_931200 Rosetta Predictions human pricing
XM_001053730 Rosetta Predictions rat pricing
XM_216357 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264082 predicted 857
2 SASI_Hs01_00264083 predicted 1058
3 SASI_Hs01_00264084 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258657 predicted 389
2 SASI_Hs01_00258658 predicted 440
3 SASI_Hs01_00258659 predicted 459
4 SASI_Hs01_00258660 predicted 379
5 SASI_Hs01_00258661 predicted 408
6 SASI_Hs01_00258662 predicted 461
7 SASI_Hs01_00258663 predicted 390
8 SASI_Hs01_00258664 predicted 381
9 SASI_Hs01_00258665 predicted 441
10 SASI_Hs01_00258666 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278494 predicted 374
2 SASI_Hs01_00278495 predicted 360
3 SASI_Hs01_00278496 predicted 359
4 SASI_Hs01_00278497 predicted 376
5 SASI_Hs01_00278498 predicted 378
6 SASI_Hs01_00278499 predicted 237
7 SASI_Hs01_00278500 predicted 197
8 SASI_Hs01_00278501 predicted 373
9 SASI_Hs01_00278502 predicted 562
10 SASI_Hs01_00278503 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301613 predicted 1880
2 SASI_Hs01_00301614 predicted 1416
3 SASI_Hs01_00301615 predicted 2076
4 SASI_Hs01_00301616 predicted 2078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293395 predicted 1011
2 SASI_Hs01_00293396 predicted 1214
3 SASI_Hs01_00293397 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273386 predicted 587
2 SASI_Rn02_00273387 predicted 372
3 SASI_Rn02_00273388 predicted 656
4 SASI_Rn02_00273389 predicted 582
5 SASI_Rn02_00273390 predicted 450
6 SASI_Rn02_00273391 predicted 849
7 SASI_Rn02_00273392 predicted 281
8 SASI_Rn02_00273393 predicted 817
9 SASI_Rn02_00273394 predicted 948
10 SASI_Rn02_00273395 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376530 predicted 582
2 SASI_Rn02_00376531 predicted 378
3 SASI_Rn02_00376532 predicted 663
4 SASI_Rn02_00376533 predicted 587
5 SASI_Rn02_00376534 predicted 450
6 SASI_Rn02_00376535 predicted 849
7 SASI_Rn02_00376536 predicted 276
8 SASI_Rn02_00376537 predicted 813
9 SASI_Rn02_00376538 predicted 947
10 SASI_Rn02_00376539 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145269
VALIDATED
FAM92A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 92, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-494s1c1
Sequence:CCGGCAGCAAGGAATCGAGAAGCTACTCGAGTAGCTTCTCGATTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-751s1c1
Sequence:CCGGGCTGCCTACCAGAATATACAACTCGAGTTGTATATTCTGGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-1078s1c1
Sequence:CCGGGAGGATGACGAGTTAGATGTTCTCGAGAACATCTAACTCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145269.2-1075s1c1
Sequence:CCGGGATGAGGATGACGAGTTAGATCTCGAGATCTAACTCGTCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-856s1c1
Sequence:CCGGGCAAATTCAAAGTCACCTCTTCTCGAGAAGAGGTGACTTTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-821s1c1
Sequence:CCGGCACCAGATTATTCATCTCGTTCTCGAGAACGAGATGAATAATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145269.2-288s1c1
Sequence:CCGGCCTCCTGGTGAATGAAATTAACTCGAGTTAATTTCATTCACCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-1063s1c1
Sequence:CCGGCAAGCAGAAGATGATGAGGATCTCGAGATCCTCATCATCTTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145269.2-1072s1c1
Sequence:CCGGGATGATGAGGATGACGAGTTACTCGAGTAACTCGTCATCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145269.2-361s1c1
Sequence:CCGGGCAGATGAGTTTGCCAAACTTCTCGAGAAGTTTGGCAAACTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145269
VALIDATED
FAM92A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 92, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-494s1c1
Sequence:CCGGCAGCAAGGAATCGAGAAGCTACTCGAGTAGCTTCTCGATTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-751s1c1
Sequence:CCGGGCTGCCTACCAGAATATACAACTCGAGTTGTATATTCTGGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-1078s1c1
Sequence:CCGGGAGGATGACGAGTTAGATGTTCTCGAGAACATCTAACTCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145269.2-1075s1c1
Sequence:CCGGGATGAGGATGACGAGTTAGATCTCGAGATCTAACTCGTCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-856s1c1
Sequence:CCGGGCAAATTCAAAGTCACCTCTTCTCGAGAAGAGGTGACTTTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-821s1c1
Sequence:CCGGCACCAGATTATTCATCTCGTTCTCGAGAACGAGATGAATAATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145269.2-288s1c1
Sequence:CCGGCCTCCTGGTGAATGAAATTAACTCGAGTTAATTTCATTCACCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-1063s1c1
Sequence:CCGGCAAGCAGAAGATGATGAGGATCTCGAGATCCTCATCATCTTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145269.2-1072s1c1
Sequence:CCGGGATGATGAGGATGACGAGTTACTCGAGTAACTCGTCATCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145269.2-361s1c1
Sequence:CCGGGCAGATGAGTTTGCCAAACTTCTCGAGAAGTTTGGCAAACTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145269
VALIDATED
FAM92A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 92, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-494s1c1
Sequence:CCGGCAGCAAGGAATCGAGAAGCTACTCGAGTAGCTTCTCGATTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-751s1c1
Sequence:CCGGGCTGCCTACCAGAATATACAACTCGAGTTGTATATTCTGGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-1078s1c1
Sequence:CCGGGAGGATGACGAGTTAGATGTTCTCGAGAACATCTAACTCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145269.2-1075s1c1
Sequence:CCGGGATGAGGATGACGAGTTAGATCTCGAGATCTAACTCGTCATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_145269.2-856s1c1
Sequence:CCGGGCAAATTCAAAGTCACCTCTTCTCGAGAAGAGGTGACTTTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-821s1c1
Sequence:CCGGCACCAGATTATTCATCTCGTTCTCGAGAACGAGATGAATAATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145269.2-288s1c1
Sequence:CCGGCCTCCTGGTGAATGAAATTAACTCGAGTTAATTTCATTCACCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145269.2-1063s1c1
Sequence:CCGGCAAGCAGAAGATGATGAGGATCTCGAGATCCTCATCATCTTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145269.2-1072s1c1
Sequence:CCGGGATGATGAGGATGACGAGTTACTCGAGTAACTCGTCATCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145269.2-361s1c1
Sequence:CCGGGCAGATGAGTTTGCCAAACTTCTCGAGAAGTTTGGCAAACTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks