EMAIL THIS PAGE TO A FRIEND

FAM92B

family with sequence similarity 92, member B

57 Gene Product Result for
UniProtKB ID: Q6ZTR7
Gene ID:
Mouse(436062) family with sequence similarity 92, member B
Rat(361423) family with sequence similarity 92, member B
cow(768078) family with sequence similarity 92, member B
dog(100684523) family with sequence similarity 92, member B
domestic guinea pig(100716204) family with sequence similarity 92, member B
naked mole-rat(101699900) family with sequence similarity 92, member B
sheep(101104678) family with sequence similarity 92, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198491 Rosetta Predictions human pricing
XM_001078819 Rosetta Predictions rat pricing
XM_341701 Rosetta Predictions rat pricing
NM_001033980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372057 predicted 213
2 SASI_Hs01_00135153 predicted 824
3 SASI_Hs01_00135154 predicted 827
4 SASI_Hs01_00135156 predicted 732
5 SASI_Hs01_00135157 predicted 834
6 SASI_Hs01_00135159 predicted 820
7 SASI_Hs01_00135160 predicted 830
8 SASI_Hs01_00135161 predicted 544
9 SASI_Hs01_00135162 predicted 364
10 SASI_Hs02_00372058 predicted 306
11 SASI_Hs01_00135155 predicted 470
12 SASI_Hs01_00135158 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362090 predicted 858
2 SASI_Rn02_00362091 predicted 315
3 SASI_Rn02_00362092 predicted 323
4 SASI_Rn02_00362093 predicted 801
5 SASI_Rn02_00362094 predicted 633
6 SASI_Rn02_00362095 predicted 593
7 SASI_Rn02_00362096 predicted 562
8 SASI_Rn02_00362097 predicted 597
9 SASI_Rn02_00362098 predicted 945
10 SASI_Rn02_00362099 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393253 predicted 1194
2 SASI_Rn02_00393254 predicted 1258
3 SASI_Rn02_00393255 predicted 1140
4 SASI_Rn02_00393256 predicted 1239
5 SASI_Rn02_00393257 predicted 1270
6 SASI_Rn02_00393258 predicted 1196
7 SASI_Rn02_00393259 predicted 1211
8 SASI_Rn02_00393260 predicted 1217
9 SASI_Rn02_00393261 predicted 1195
10 SASI_Rn02_00393262 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073862 predicted 790
2 SASI_Mm01_00073863 predicted 669
3 SASI_Mm01_00073864 predicted 351
4 SASI_Mm02_00289068 predicted 287
5 SASI_Mm01_00073867 predicted 791
6 SASI_Mm01_00073868 predicted 733
7 SASI_Mm01_00073869 predicted 422
8 SASI_Mm01_00073870 predicted 803
9 SASI_Mm01_00073871 predicted 293
10 SASI_Mm02_00289069 predicted 542
11 SASI_Mm01_00073865 predicted 271
12 SASI_Mm01_00073866 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198491
FAM92B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 92, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198491.1-1522s1c1
Sequence:CCGGGCTGCCATTATCATTACTGATCTCGAGATCAGTAATGATAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-704s1c1
Sequence:CCGGGTGACTTTGTAACTATTGAGACTCGAGTCTCAATAGTTACAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198491.1-1239s1c1
Sequence:CCGGGCTGAGACTTTCCAGAGCATTCTCGAGAATGCTCTGGAAAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-949s1c1
Sequence:CCGGCCTGAACATCCTCATGCCAATCTCGAGATTGGCATGAGGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-841s1c1
Sequence:CCGGCATTATGACACTCGGCTGCTTCTCGAGAAGCAGCCGAGTGTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198491.1-558s21c1
Sequence:CCGGGTCACCCTCGGATCAGCAAATCTCGAGATTTGCTGATCCGAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198491.1-1086s21c1
Sequence:CCGGTGCAATCCCAAGCCGTTTAAACTCGAGTTTAAACGGCTTGGGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198491.1-1451s21c1
Sequence:CCGGTATCAGATGAACAGATCTATACTCGAGTATAGATCTGTTCATCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198491.1-738s21c1
Sequence:CCGGCAAAGCGGTGGAGGTGTATTCCTCGAGGAATACACCTCCACCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198491
FAM92B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 92, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198491.1-1522s1c1
Sequence:CCGGGCTGCCATTATCATTACTGATCTCGAGATCAGTAATGATAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-704s1c1
Sequence:CCGGGTGACTTTGTAACTATTGAGACTCGAGTCTCAATAGTTACAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198491.1-1239s1c1
Sequence:CCGGGCTGAGACTTTCCAGAGCATTCTCGAGAATGCTCTGGAAAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-949s1c1
Sequence:CCGGCCTGAACATCCTCATGCCAATCTCGAGATTGGCATGAGGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-841s1c1
Sequence:CCGGCATTATGACACTCGGCTGCTTCTCGAGAAGCAGCCGAGTGTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198491.1-558s21c1
Sequence:CCGGGTCACCCTCGGATCAGCAAATCTCGAGATTTGCTGATCCGAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198491.1-1086s21c1
Sequence:CCGGTGCAATCCCAAGCCGTTTAAACTCGAGTTTAAACGGCTTGGGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198491.1-1451s21c1
Sequence:CCGGTATCAGATGAACAGATCTATACTCGAGTATAGATCTGTTCATCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198491.1-738s21c1
Sequence:CCGGCAAAGCGGTGGAGGTGTATTCCTCGAGGAATACACCTCCACCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198491
FAM92B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 92, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198491.1-1522s1c1
Sequence:CCGGGCTGCCATTATCATTACTGATCTCGAGATCAGTAATGATAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-704s1c1
Sequence:CCGGGTGACTTTGTAACTATTGAGACTCGAGTCTCAATAGTTACAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198491.1-1239s1c1
Sequence:CCGGGCTGAGACTTTCCAGAGCATTCTCGAGAATGCTCTGGAAAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-949s1c1
Sequence:CCGGCCTGAACATCCTCATGCCAATCTCGAGATTGGCATGAGGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198491.1-841s1c1
Sequence:CCGGCATTATGACACTCGGCTGCTTCTCGAGAAGCAGCCGAGTGTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198491.1-558s21c1
Sequence:CCGGGTCACCCTCGGATCAGCAAATCTCGAGATTTGCTGATCCGAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198491.1-1086s21c1
Sequence:CCGGTGCAATCCCAAGCCGTTTAAACTCGAGTTTAAACGGCTTGGGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198491.1-1451s21c1
Sequence:CCGGTATCAGATGAACAGATCTATACTCGAGTATAGATCTGTTCATCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198491.1-738s21c1
Sequence:CCGGCAAAGCGGTGGAGGTGTATTCCTCGAGGAATACACCTCCACCGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033980
FAM92B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 92, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-795s21c1
Sequence:CCGGGAGCCAAGACGCGTGGAATTTCTCGAGAAATTCCACGCGTCTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-429s21c1
Sequence:CCGGAGCTCTACGGTGCCCAAATAACTCGAGTTATTTGGGCACCGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033980.1-1018s21c1
Sequence:CCGGAGAGGATTTCAGTGGCAGGAGCTCGAGCTCCTGCCACTGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-360s21c1
Sequence:CCGGTTGCCAAAGTGCAGGATTATCCTCGAGGATAATCCTGCACTTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-538s21c1
Sequence:CCGGGTCACCCTCAGATCGACAAATCTCGAGATTTGTCGATCTGAGGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033980
FAM92B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 92, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-795s21c1
Sequence:CCGGGAGCCAAGACGCGTGGAATTTCTCGAGAAATTCCACGCGTCTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-429s21c1
Sequence:CCGGAGCTCTACGGTGCCCAAATAACTCGAGTTATTTGGGCACCGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033980.1-1018s21c1
Sequence:CCGGAGAGGATTTCAGTGGCAGGAGCTCGAGCTCCTGCCACTGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-360s21c1
Sequence:CCGGTTGCCAAAGTGCAGGATTATCCTCGAGGATAATCCTGCACTTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-538s21c1
Sequence:CCGGGTCACCCTCAGATCGACAAATCTCGAGATTTGTCGATCTGAGGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033980
FAM92B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 92, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-795s21c1
Sequence:CCGGGAGCCAAGACGCGTGGAATTTCTCGAGAAATTCCACGCGTCTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-429s21c1
Sequence:CCGGAGCTCTACGGTGCCCAAATAACTCGAGTTATTTGGGCACCGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033980.1-1018s21c1
Sequence:CCGGAGAGGATTTCAGTGGCAGGAGCTCGAGCTCCTGCCACTGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-360s21c1
Sequence:CCGGTTGCCAAAGTGCAGGATTATCCTCGAGGATAATCCTGCACTTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033980.1-538s21c1
Sequence:CCGGGTCACCCTCAGATCGACAAATCTCGAGATTTGTCGATCTGAGGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks