EMAIL THIS PAGE TO A FRIEND

FAM96A

family with sequence similarity 96, member A

UniProtKB ID: Q9H5X1, A6NKS1, B2R5F8, B7Z8Z5
Gene ID:
Mouse(68250) family with sequence similarity 96, member A
Rat(300797) family with sequence similarity 96, member A
chicken(415571) family with sequence similarity 96, member A
domestic cat(101089269) family with sequence similarity 96, member A
cow(512871) family with sequence similarity 96, member A
Horse(100053881) family with sequence similarity 96, member A
sheep(101110334) family with sequence similarity 96, member A
naked mole-rat(101707751) family with sequence similarity 96, member A
domestic guinea pig(100729879) family with sequence similarity 96, member A
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014812 Rosetta Predictions human pricing
NM_032231 Rosetta Predictions human pricing
NM_001008327 Rosetta Predictions rat pricing
NM_026635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191795 predicted 739
2 SASI_Hs01_00191796 predicted 798
3 SASI_Hs01_00191797 predicted 794
4 SASI_Hs01_00191798 predicted 282
5 SASI_Hs01_00191799 predicted 758
6 SASI_Hs01_00191800 predicted 735
7 SASI_Hs01_00191801 predicted 799
8 SASI_Hs01_00191802 predicted 746
9 SASI_Hs01_00191803 predicted 236
10 SASI_Hs02_00306576 predicted 733
11 SASI_Hs01_00191794 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238796 predicted 785
2 SASI_Hs01_00238797 predicted 842
3 SASI_Hs02_00359543 predicted 838
4 SASI_Hs01_00238798 predicted 283
5 SASI_Hs01_00238799 predicted 807
6 SASI_Hs01_00238800 predicted 786
7 SASI_Hs01_00238801 predicted 846
8 SASI_Hs01_00238802 predicted 795
9 SASI_Hs01_00238803 predicted 245
10 SASI_Hs01_00238804 predicted 781
11 SASI_Hs01_00238795 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103500 predicted 323
2 SASI_Rn02_00199069 predicted 318
3 SASI_Rn01_00103501 predicted 303
4 SASI_Rn01_00103502 predicted 232
5 SASI_Rn01_00103503 predicted 459
6 SASI_Rn01_00103504 predicted 407
7 SASI_Rn01_00103506 predicted 342
8 SASI_Rn01_00103507 predicted 418
9 SASI_Rn01_00103508 predicted 381
10 SASI_Rn01_00103509 predicted 393
11 SASI_Rn01_00103505 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330612 predicted 407
2 SASI_Mm02_00330613 predicted 560
3 SASI_Mm02_00330614 predicted 253
4 SASI_Mm02_00330615 predicted 389
5 SASI_Mm02_00330616 predicted 565
6 SASI_Mm02_00330617 predicted 488
7 SASI_Mm02_00330618 predicted 521
8 SASI_Mm02_00330619 predicted 458
9 SASI_Mm02_00330620 predicted 495
10 SASI_Mm02_00330621 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026635
VALIDATED
FAM96A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 96, member A
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-1003s21c1
Sequence:CCGGGAGGATTCTTTCTGAGCAAATCTCGAGATTTGCTCAGAAAGAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-759s21c1
Sequence:CCGGGCTAGTTTCAATCCTTTGTAACTCGAGTTACAAAGGATTGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-570s21c1
Sequence:CCGGCACAAGTTGGAAATCTACATTCTCGAGAATGTAGATTTCCAACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-793s21c1
Sequence:CCGGCATGTTGACTAGATAGGTGATCTCGAGATCACCTATCTAGTCAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-471s21c1
Sequence:CCGGGTTATTATCAAGTTCACACCACTCGAGTGGTGTGAACTTGATAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-606s1c1
Sequence:CCGGCTCGACAGAAGAAGACATCAACTCGAGTTGATGTCTTCTTCTGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-562s1c1
Sequence:CCGGCCGTTCAAACACAAGTTGGAACTCGAGTTCCAACTTGTGTTTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-337s1c1
Sequence:CCGGGAAGAGAAAGCGCTAGAAGTTCTCGAGAACTTCTAGCGCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026635.2-760s1c1
Sequence:CCGGGCTAGTTTCAATCCTTTGTAACTCGAGTTACAAAGGATTGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-472s1c1
Sequence:CCGGGTTATTATCAAGTTCACACCACTCGAGTGGTGTGAACTTGATAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-571s1c1
Sequence:CCGGCACAAGTTGGAAATCTACATTCTCGAGAATGTAGATTTCCAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-794s1c1
Sequence:CCGGCATGTTGACTAGATAGGTGATCTCGAGATCACCTATCTAGTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-1004s1c1
Sequence:CCGGGAGGATTCTTTCTGAGCAAATCTCGAGATTTGCTCAGAAAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-631s1c1
Sequence:CCGGCAGATAAATGACAAAGAGCGACTCGAGTCGCTCTTTGTCATTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-619s1c1
Sequence:CCGGGACATCAACAAGCAGATAAATCTCGAGATTTATCTGCTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026635
VALIDATED
FAM96A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 96, member A
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-1003s21c1
Sequence:CCGGGAGGATTCTTTCTGAGCAAATCTCGAGATTTGCTCAGAAAGAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-759s21c1
Sequence:CCGGGCTAGTTTCAATCCTTTGTAACTCGAGTTACAAAGGATTGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-570s21c1
Sequence:CCGGCACAAGTTGGAAATCTACATTCTCGAGAATGTAGATTTCCAACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-793s21c1
Sequence:CCGGCATGTTGACTAGATAGGTGATCTCGAGATCACCTATCTAGTCAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-471s21c1
Sequence:CCGGGTTATTATCAAGTTCACACCACTCGAGTGGTGTGAACTTGATAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-606s1c1
Sequence:CCGGCTCGACAGAAGAAGACATCAACTCGAGTTGATGTCTTCTTCTGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-562s1c1
Sequence:CCGGCCGTTCAAACACAAGTTGGAACTCGAGTTCCAACTTGTGTTTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-337s1c1
Sequence:CCGGGAAGAGAAAGCGCTAGAAGTTCTCGAGAACTTCTAGCGCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026635.2-760s1c1
Sequence:CCGGGCTAGTTTCAATCCTTTGTAACTCGAGTTACAAAGGATTGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-472s1c1
Sequence:CCGGGTTATTATCAAGTTCACACCACTCGAGTGGTGTGAACTTGATAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-571s1c1
Sequence:CCGGCACAAGTTGGAAATCTACATTCTCGAGAATGTAGATTTCCAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-794s1c1
Sequence:CCGGCATGTTGACTAGATAGGTGATCTCGAGATCACCTATCTAGTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-1004s1c1
Sequence:CCGGGAGGATTCTTTCTGAGCAAATCTCGAGATTTGCTCAGAAAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-631s1c1
Sequence:CCGGCAGATAAATGACAAAGAGCGACTCGAGTCGCTCTTTGTCATTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-619s1c1
Sequence:CCGGGACATCAACAAGCAGATAAATCTCGAGATTTATCTGCTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026635
VALIDATED
FAM96A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 96, member A
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-1003s21c1
Sequence:CCGGGAGGATTCTTTCTGAGCAAATCTCGAGATTTGCTCAGAAAGAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-759s21c1
Sequence:CCGGGCTAGTTTCAATCCTTTGTAACTCGAGTTACAAAGGATTGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-570s21c1
Sequence:CCGGCACAAGTTGGAAATCTACATTCTCGAGAATGTAGATTTCCAACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-793s21c1
Sequence:CCGGCATGTTGACTAGATAGGTGATCTCGAGATCACCTATCTAGTCAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026635.3-471s21c1
Sequence:CCGGGTTATTATCAAGTTCACACCACTCGAGTGGTGTGAACTTGATAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-606s1c1
Sequence:CCGGCTCGACAGAAGAAGACATCAACTCGAGTTGATGTCTTCTTCTGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-562s1c1
Sequence:CCGGCCGTTCAAACACAAGTTGGAACTCGAGTTCCAACTTGTGTTTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-337s1c1
Sequence:CCGGGAAGAGAAAGCGCTAGAAGTTCTCGAGAACTTCTAGCGCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026635.2-760s1c1
Sequence:CCGGGCTAGTTTCAATCCTTTGTAACTCGAGTTACAAAGGATTGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-472s1c1
Sequence:CCGGGTTATTATCAAGTTCACACCACTCGAGTGGTGTGAACTTGATAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-571s1c1
Sequence:CCGGCACAAGTTGGAAATCTACATTCTCGAGAATGTAGATTTCCAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-794s1c1
Sequence:CCGGCATGTTGACTAGATAGGTGATCTCGAGATCACCTATCTAGTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026635.2-1004s1c1
Sequence:CCGGGAGGATTCTTTCTGAGCAAATCTCGAGATTTGCTCAGAAAGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-631s1c1
Sequence:CCGGCAGATAAATGACAAAGAGCGACTCGAGTCGCTCTTTGTCATTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026635.2-619s1c1
Sequence:CCGGGACATCAACAAGCAGATAAATCTCGAGATTTATCTGCTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032231
VALIDATED
FAM96A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 96, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-868s21c1
Sequence:CCGGTATAAGGTAGTACCTAATTTGCTCGAGCAAATTAGGTACTACCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-622s21c1
Sequence:CCGGGACATCAATAAGCAGATAAATCTCGAGATTTATCTGCTTATTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-552s21c1
Sequence:CCGGTCAGCGATGTTTACCATTTAACTCGAGTTAAATGGTAAACATCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-439s21c1
Sequence:CCGGGTGGAAGTTCAGGAGATAAATCTCGAGATTTATCTCCTGAACTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-489s21c1
Sequence:CCGGCACGCCAACAGTACCTCATTGCTCGAGCAATGAGGTACTGTTGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-242s1c1
Sequence:CCGGGAAGAGAAAGCGCTAGAGGTTCTCGAGAACCTCTAGCGCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-521s1c1
Sequence:CCGGGAAGACATCAATAAGCAGATACTCGAGTATCTGCTTATTGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-253s1c1
Sequence:CCGGGCTAGAGGTTTATGATTTGATCTCGAGATCAAATCATAAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032231
VALIDATED
FAM96A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 96, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-868s21c1
Sequence:CCGGTATAAGGTAGTACCTAATTTGCTCGAGCAAATTAGGTACTACCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-622s21c1
Sequence:CCGGGACATCAATAAGCAGATAAATCTCGAGATTTATCTGCTTATTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-552s21c1
Sequence:CCGGTCAGCGATGTTTACCATTTAACTCGAGTTAAATGGTAAACATCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-439s21c1
Sequence:CCGGGTGGAAGTTCAGGAGATAAATCTCGAGATTTATCTCCTGAACTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-489s21c1
Sequence:CCGGCACGCCAACAGTACCTCATTGCTCGAGCAATGAGGTACTGTTGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-242s1c1
Sequence:CCGGGAAGAGAAAGCGCTAGAGGTTCTCGAGAACCTCTAGCGCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-521s1c1
Sequence:CCGGGAAGACATCAATAAGCAGATACTCGAGTATCTGCTTATTGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-253s1c1
Sequence:CCGGGCTAGAGGTTTATGATTTGATCTCGAGATCAAATCATAAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032231
VALIDATED
FAM96A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 96, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-868s21c1
Sequence:CCGGTATAAGGTAGTACCTAATTTGCTCGAGCAAATTAGGTACTACCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-622s21c1
Sequence:CCGGGACATCAATAAGCAGATAAATCTCGAGATTTATCTGCTTATTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-552s21c1
Sequence:CCGGTCAGCGATGTTTACCATTTAACTCGAGTTAAATGGTAAACATCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-439s21c1
Sequence:CCGGGTGGAAGTTCAGGAGATAAATCTCGAGATTTATCTCCTGAACTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032231.4-489s21c1
Sequence:CCGGCACGCCAACAGTACCTCATTGCTCGAGCAATGAGGTACTGTTGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-242s1c1
Sequence:CCGGGAAGAGAAAGCGCTAGAGGTTCTCGAGAACCTCTAGCGCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-521s1c1
Sequence:CCGGGAAGACATCAATAAGCAGATACTCGAGTATCTGCTTATTGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032231.3-253s1c1
Sequence:CCGGGCTAGAGGTTTATGATTTGATCTCGAGATCAAATCATAAACCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks