EMAIL THIS PAGE TO A FRIEND

FAM96B

family with sequence similarity 96, member B

49 Gene Product Result for
Synonyms: MIP18
UniProtKB ID: Q9Y3D0
Gene ID:
Mouse(68523) family with sequence similarity 96, member B
Rat(680987) family with sequence similarity 96, member B
Zebrafish(436722) family with sequence similarity 96, member B
cow(614585) family with sequence similarity 96, member B
Horse(100052873) family with sequence similarity 96, member B
domestic cat(101096525) family with sequence similarity 96, member B
dog(611301) family with sequence similarity 96, member B
chicken(415789) family with sequence similarity 96, member B
domestic guinea pig(100725213) family with sequence similarity 96, member B
naked mole-rat(101726720) family with sequence similarity 96, member B
sheep(101109473) family with sequence similarity 96, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016062 Rosetta Predictions human pricing
XM_001058416 Rosetta Predictions rat pricing
NM_026753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141662 predicted 211
2 SASI_Hs01_00141664 predicted 222
3 SASI_Hs01_00141665 predicted 210
4 SASI_Hs01_00141666 predicted 196
5 SASI_Hs01_00141667 predicted 279
6 SASI_Hs01_00141668 predicted 213
7 SASI_Hs01_00141669 predicted 279
8 SASI_Hs01_00141670 predicted 207
9 SASI_Hs01_00141671 predicted 266
10 SASI_Hs02_00348795 predicted 317
11 SASI_Hs01_00141663 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289633 predicted 379
2 SASI_Rn02_00289634 predicted 324
3 SASI_Rn02_00289635 predicted 333
4 SASI_Rn02_00289636 predicted 421
5 SASI_Rn02_00289637 predicted 415
6 SASI_Rn02_00289638 predicted 438
7 SASI_Rn02_00289639 predicted 319
8 SASI_Rn02_00289640 predicted 280
9 SASI_Rn02_00289641 predicted 334
10 SASI_Rn02_00289642 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172262 predicted 322
2 SASI_Mm01_00172263 predicted 210
3 SASI_Mm01_00172264 predicted 327
4 SASI_Mm01_00172265 predicted 324
5 SASI_Mm01_00172266 predicted 413
6 SASI_Mm01_00172267 predicted 208
7 SASI_Mm01_00172268 predicted 434
8 SASI_Mm01_00172269 predicted 258
9 SASI_Mm01_00172270 predicted 217
10 SASI_Mm01_00172271 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016062
VALIDATED
FAM96B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 96, member B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-420s1c1
Sequence:CCGGGAGCATGCAGTGAACAAGCAACTCGAGTTGCTTGTTCACTGCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-429s1c1
Sequence:CCGGGTGAACAAGCAACTTGCAGATCTCGAGATCTGCAAGTTGCTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-219s1c1
Sequence:CCGGCTAGAGGAGTTGAACGTAGTACTCGAGTACTACGTTCAACTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-431s1c1
Sequence:CCGGGAACAAGCAACTTGCAGATAACTCGAGTTATCTGCAAGTTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-177s1c1
Sequence:CCGGGATCTGATTCGCTCCATCAATCTCGAGATTGATGGAGCGAATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-426s1c1
Sequence:CCGGGCAGTGAACAAGCAACTTGCACTCGAGTGCAAGTTGCTTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-165s1c1
Sequence:CCGGCGCGAGATCTTCGATCTGATTCTCGAGAATCAGATCGAAGATCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-173s1c1
Sequence:CCGGCTTCGATCTGATTCGCTCCATCTCGAGATGGAGCGAATCAGATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-330s21c1
Sequence:CCGGTGCAGCATGGCCACCCTTATTCTCGAGAATAAGGGTGGCCATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-397s21c1
Sequence:CCGGTCAAGATGGACGTGCACATTACTCGAGTAATGTGCACGTCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-191s21c1
Sequence:CCGGCTTCGATCTGATTCGCTCCATCTCGAGATGGAGCGAATCAGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-449s21c1
Sequence:CCGGGAACAAGCAACTTGCAGATAACTCGAGTTATCTGCAAGTTGCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-237s21c1
Sequence:CCGGCTAGAGGAGTTGAACGTAGTACTCGAGTACTACGTTCAACTCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016062
VALIDATED
FAM96B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 96, member B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-420s1c1
Sequence:CCGGGAGCATGCAGTGAACAAGCAACTCGAGTTGCTTGTTCACTGCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-429s1c1
Sequence:CCGGGTGAACAAGCAACTTGCAGATCTCGAGATCTGCAAGTTGCTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-219s1c1
Sequence:CCGGCTAGAGGAGTTGAACGTAGTACTCGAGTACTACGTTCAACTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-431s1c1
Sequence:CCGGGAACAAGCAACTTGCAGATAACTCGAGTTATCTGCAAGTTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-177s1c1
Sequence:CCGGGATCTGATTCGCTCCATCAATCTCGAGATTGATGGAGCGAATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-426s1c1
Sequence:CCGGGCAGTGAACAAGCAACTTGCACTCGAGTGCAAGTTGCTTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-165s1c1
Sequence:CCGGCGCGAGATCTTCGATCTGATTCTCGAGAATCAGATCGAAGATCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-173s1c1
Sequence:CCGGCTTCGATCTGATTCGCTCCATCTCGAGATGGAGCGAATCAGATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-330s21c1
Sequence:CCGGTGCAGCATGGCCACCCTTATTCTCGAGAATAAGGGTGGCCATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-397s21c1
Sequence:CCGGTCAAGATGGACGTGCACATTACTCGAGTAATGTGCACGTCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-191s21c1
Sequence:CCGGCTTCGATCTGATTCGCTCCATCTCGAGATGGAGCGAATCAGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-449s21c1
Sequence:CCGGGAACAAGCAACTTGCAGATAACTCGAGTTATCTGCAAGTTGCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-237s21c1
Sequence:CCGGCTAGAGGAGTTGAACGTAGTACTCGAGTACTACGTTCAACTCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016062
VALIDATED
FAM96B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 96, member B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-420s1c1
Sequence:CCGGGAGCATGCAGTGAACAAGCAACTCGAGTTGCTTGTTCACTGCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-429s1c1
Sequence:CCGGGTGAACAAGCAACTTGCAGATCTCGAGATCTGCAAGTTGCTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-219s1c1
Sequence:CCGGCTAGAGGAGTTGAACGTAGTACTCGAGTACTACGTTCAACTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-431s1c1
Sequence:CCGGGAACAAGCAACTTGCAGATAACTCGAGTTATCTGCAAGTTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016062.1-177s1c1
Sequence:CCGGGATCTGATTCGCTCCATCAATCTCGAGATTGATGGAGCGAATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-426s1c1
Sequence:CCGGGCAGTGAACAAGCAACTTGCACTCGAGTGCAAGTTGCTTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-165s1c1
Sequence:CCGGCGCGAGATCTTCGATCTGATTCTCGAGAATCAGATCGAAGATCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016062.1-173s1c1
Sequence:CCGGCTTCGATCTGATTCGCTCCATCTCGAGATGGAGCGAATCAGATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-330s21c1
Sequence:CCGGTGCAGCATGGCCACCCTTATTCTCGAGAATAAGGGTGGCCATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-397s21c1
Sequence:CCGGTCAAGATGGACGTGCACATTACTCGAGTAATGTGCACGTCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-191s21c1
Sequence:CCGGCTTCGATCTGATTCGCTCCATCTCGAGATGGAGCGAATCAGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-449s21c1
Sequence:CCGGGAACAAGCAACTTGCAGATAACTCGAGTTATCTGCAAGTTGCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016062.2-237s21c1
Sequence:CCGGCTAGAGGAGTTGAACGTAGTACTCGAGTACTACGTTCAACTCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026753
VALIDATED
FAM96B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 96, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-432s1c1
Sequence:CCGGGCAGTGAACAAACAACTTGCACTCGAGTGCAAGTTGTTTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-231s1c1
Sequence:CCGGGAATTGAACGTAGTAGAGCAACTCGAGTTGCTCTACTACGTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-498s1c1
Sequence:CCGGGAGGTTGTTAATCAGTGTTTACTCGAGTAAACACTGATTAACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-421s21c1
Sequence:CCGGCCGAGCATGCAGTGAACAAACCTCGAGGTTTGTTCACTGCATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026753.2-167s21c1
Sequence:CCGGCCGGGAGATCTTCGATCTTATCTCGAGATAAGATCGAAGATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026753.2-485s21c1
Sequence:CCGGACACCTGCTTGAGGTTGTTAACTCGAGTTAACAACCTCAAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-315s21c1
Sequence:CCGGTGCAGCATGGCCACGCTTATTCTCGAGAATAAGCGTGGCCATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-382s21c1
Sequence:CCGGTCAAGATGGATGTACACATTACTCGAGTAATGTGTACATCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026753
VALIDATED
FAM96B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 96, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-432s1c1
Sequence:CCGGGCAGTGAACAAACAACTTGCACTCGAGTGCAAGTTGTTTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-231s1c1
Sequence:CCGGGAATTGAACGTAGTAGAGCAACTCGAGTTGCTCTACTACGTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-498s1c1
Sequence:CCGGGAGGTTGTTAATCAGTGTTTACTCGAGTAAACACTGATTAACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-421s21c1
Sequence:CCGGCCGAGCATGCAGTGAACAAACCTCGAGGTTTGTTCACTGCATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026753.2-167s21c1
Sequence:CCGGCCGGGAGATCTTCGATCTTATCTCGAGATAAGATCGAAGATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026753.2-485s21c1
Sequence:CCGGACACCTGCTTGAGGTTGTTAACTCGAGTTAACAACCTCAAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-315s21c1
Sequence:CCGGTGCAGCATGGCCACGCTTATTCTCGAGAATAAGCGTGGCCATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-382s21c1
Sequence:CCGGTCAAGATGGATGTACACATTACTCGAGTAATGTGTACATCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026753
VALIDATED
FAM96B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 96, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-432s1c1
Sequence:CCGGGCAGTGAACAAACAACTTGCACTCGAGTGCAAGTTGTTTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-231s1c1
Sequence:CCGGGAATTGAACGTAGTAGAGCAACTCGAGTTGCTCTACTACGTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026753.1-498s1c1
Sequence:CCGGGAGGTTGTTAATCAGTGTTTACTCGAGTAAACACTGATTAACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-421s21c1
Sequence:CCGGCCGAGCATGCAGTGAACAAACCTCGAGGTTTGTTCACTGCATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026753.2-167s21c1
Sequence:CCGGCCGGGAGATCTTCGATCTTATCTCGAGATAAGATCGAAGATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026753.2-485s21c1
Sequence:CCGGACACCTGCTTGAGGTTGTTAACTCGAGTTAACAACCTCAAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-315s21c1
Sequence:CCGGTGCAGCATGGCCACGCTTATTCTCGAGAATAAGCGTGGCCATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026753.2-382s21c1
Sequence:CCGGTCAAGATGGATGTACACATTACTCGAGTAATGTGTACATCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks