EMAIL THIS PAGE TO A FRIEND

FAM98A

family with sequence similarity 98, member A

127 Gene Product Result for
UniProtKB ID: Q8NCA5, B2RNA2, Q9Y3Y6
Gene ID:
Mouse(72722) family with sequence similarity 98, member A
Rat(313873) family with sequence similarity 98, member A
sheep(101123542) family with sequence similarity 98, member A
naked mole-rat(101719310) family with sequence similarity 98, member A
domestic guinea pig(100734363) family with sequence similarity 98, member A
Zebrafish(559900) family with sequence similarity 98, member A
cow(530070) family with sequence similarity 98, member A
domestic cat(101082230) family with sequence similarity 98, member A
dog(475721) family with sequence similarity 98, member A
chicken(421458) family with sequence similarity 98, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015475 Rosetta Predictions human pricing
NM_001014073 Rosetta Predictions rat pricing
NM_133747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144970 predicted 1701
2 SASI_Hs01_00144971 predicted 1825
3 SASI_Hs01_00144972 predicted 1879
4 SASI_Hs01_00144973 predicted 814
5 SASI_Hs02_00347916 predicted 285
6 SASI_Hs01_00144974 predicted 2023
7 SASI_Hs01_00144975 predicted 1794
8 SASI_Hs01_00144976 predicted 227
9 SASI_Hs01_00144977 predicted 285
10 SASI_Hs01_00144978 predicted 1795
11 SASI_Hs01_00144969 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093233 predicted 607
2 SASI_Rn01_00093234 predicted 1529
3 SASI_Rn01_00093235 predicted 846
4 SASI_Rn01_00093236 predicted 503
5 SASI_Rn01_00093237 predicted 1546
6 SASI_Rn01_00093238 predicted 1632
7 SASI_Rn01_00093239 predicted 882
8 SASI_Rn01_00093240 predicted 333
9 SASI_Rn01_00093241 predicted 1681
10 SASI_Rn01_00093242 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056907 predicted 1621
2 SASI_Mm01_00056908 predicted 593
3 SASI_Mm01_00056909 predicted 1425
4 SASI_Mm01_00056910 predicted 627
5 SASI_Mm01_00056911 predicted 1721
6 SASI_Mm01_00056912 predicted 362
7 SASI_Mm01_00056913 predicted 1653
8 SASI_Mm01_00056914 predicted 877
9 SASI_Mm01_00056916 predicted 1631
10 SASI_Mm02_00338734 predicted 638
11 SASI_Mm01_00056915 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133747
VALIDATED
FAM98A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 98, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1721s21c1
Sequence:CCGGTTGCTAGAGCTCAAGTAATAGCTCGAGCTATTACTTGAGCTCTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1673s21c1
Sequence:CCGGTTGGACAAGGAAGACATTATACTCGAGTATAATGTCTTCCTTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-913s21c1
Sequence:CCGGCGCTCACTCTTGTCGCCTAAACTCGAGTTTAGGCGACAAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-620s21c1
Sequence:CCGGCCAAACCTCCAGCCAATATAACTCGAGTTATATTGGCTGGAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1954s21c1
Sequence:CCGGGCCTTTAGTTGACCGGTAAACCTCGAGGTTTACCGGTCAACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1335s21c1
Sequence:CCGGGGACGGTGCTTATCGAGATTCCTCGAGGAATCTCGATAAGCACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1647s21c1
Sequence:CCGGAGGCTATCAGTATAGTCATTCCTCGAGGAATGACTATACTGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133747.1-674s1c1
Sequence:CCGGCCAAGCCATAGCCAATGAATACTCGAGTATTCATTGGCTATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133747.1-707s1c1
Sequence:CCGGGAAGCTGCTAATCAAACGCTTCTCGAGAAGCGTTTGATTAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133747
VALIDATED
FAM98A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 98, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1721s21c1
Sequence:CCGGTTGCTAGAGCTCAAGTAATAGCTCGAGCTATTACTTGAGCTCTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1673s21c1
Sequence:CCGGTTGGACAAGGAAGACATTATACTCGAGTATAATGTCTTCCTTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-913s21c1
Sequence:CCGGCGCTCACTCTTGTCGCCTAAACTCGAGTTTAGGCGACAAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-620s21c1
Sequence:CCGGCCAAACCTCCAGCCAATATAACTCGAGTTATATTGGCTGGAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1954s21c1
Sequence:CCGGGCCTTTAGTTGACCGGTAAACCTCGAGGTTTACCGGTCAACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1335s21c1
Sequence:CCGGGGACGGTGCTTATCGAGATTCCTCGAGGAATCTCGATAAGCACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1647s21c1
Sequence:CCGGAGGCTATCAGTATAGTCATTCCTCGAGGAATGACTATACTGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133747.1-674s1c1
Sequence:CCGGCCAAGCCATAGCCAATGAATACTCGAGTATTCATTGGCTATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133747.1-707s1c1
Sequence:CCGGGAAGCTGCTAATCAAACGCTTCTCGAGAAGCGTTTGATTAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133747
VALIDATED
FAM98A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 98, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1721s21c1
Sequence:CCGGTTGCTAGAGCTCAAGTAATAGCTCGAGCTATTACTTGAGCTCTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1673s21c1
Sequence:CCGGTTGGACAAGGAAGACATTATACTCGAGTATAATGTCTTCCTTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-913s21c1
Sequence:CCGGCGCTCACTCTTGTCGCCTAAACTCGAGTTTAGGCGACAAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-620s21c1
Sequence:CCGGCCAAACCTCCAGCCAATATAACTCGAGTTATATTGGCTGGAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1954s21c1
Sequence:CCGGGCCTTTAGTTGACCGGTAAACCTCGAGGTTTACCGGTCAACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1335s21c1
Sequence:CCGGGGACGGTGCTTATCGAGATTCCTCGAGGAATCTCGATAAGCACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133747.2-1647s21c1
Sequence:CCGGAGGCTATCAGTATAGTCATTCCTCGAGGAATGACTATACTGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133747.1-674s1c1
Sequence:CCGGCCAAGCCATAGCCAATGAATACTCGAGTATTCATTGGCTATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133747.1-707s1c1
Sequence:CCGGGAAGCTGCTAATCAAACGCTTCTCGAGAAGCGTTTGATTAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015475
VALIDATED
FAM98A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 98, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-913s21c1
Sequence:CCGGGGACAAGCAGCGGCTCTATAACTCGAGTTATAGAGCCGCTGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-2189s21c1
Sequence:CCGGGCACATTCAGTAGCCTTATTTCTCGAGAAATAAGGCTACTGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-495s21c1
Sequence:CCGGGAGGTCTTTCAAGAGTTGAAACTCGAGTTTCAACTCTTGAAAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-2285s21c1
Sequence:CCGGGCAAACTAAGTTGTGAAGCTACTCGAGTAGCTTCACAACTTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-541s21c1
Sequence:CCGGCCAAACCTCCAGCCAATATAACTCGAGTTATATTGGCTGGAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-495s1c1
Sequence:CCGGGAGGTCTTTCAAGAGTTGAAACTCGAGTTTCAACTCTTGAAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015475.2-1407s1c1
Sequence:CCGGCAGGACAATAGATACCAAGATCTCGAGATCTTGGTATCTATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2560s1c1
Sequence:CCGGCCCTTTATTATTGCTGCAGAACTCGAGTTCTGCAGCAATAATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2288s1c1
Sequence:CCGGGCAAACTAAGTTGTGAAGCTACTCGAGTAGCTTCACAACTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2192s1c1
Sequence:CCGGGCACATTCAGTAGCCTTATTTCTCGAGAAATAAGGCTACTGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015475
VALIDATED
FAM98A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 98, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-913s21c1
Sequence:CCGGGGACAAGCAGCGGCTCTATAACTCGAGTTATAGAGCCGCTGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-2189s21c1
Sequence:CCGGGCACATTCAGTAGCCTTATTTCTCGAGAAATAAGGCTACTGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-495s21c1
Sequence:CCGGGAGGTCTTTCAAGAGTTGAAACTCGAGTTTCAACTCTTGAAAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-2285s21c1
Sequence:CCGGGCAAACTAAGTTGTGAAGCTACTCGAGTAGCTTCACAACTTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-541s21c1
Sequence:CCGGCCAAACCTCCAGCCAATATAACTCGAGTTATATTGGCTGGAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-495s1c1
Sequence:CCGGGAGGTCTTTCAAGAGTTGAAACTCGAGTTTCAACTCTTGAAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015475.2-1407s1c1
Sequence:CCGGCAGGACAATAGATACCAAGATCTCGAGATCTTGGTATCTATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2560s1c1
Sequence:CCGGCCCTTTATTATTGCTGCAGAACTCGAGTTCTGCAGCAATAATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2288s1c1
Sequence:CCGGGCAAACTAAGTTGTGAAGCTACTCGAGTAGCTTCACAACTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2192s1c1
Sequence:CCGGGCACATTCAGTAGCCTTATTTCTCGAGAAATAAGGCTACTGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015475
VALIDATED
FAM98A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 98, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-913s21c1
Sequence:CCGGGGACAAGCAGCGGCTCTATAACTCGAGTTATAGAGCCGCTGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-2189s21c1
Sequence:CCGGGCACATTCAGTAGCCTTATTTCTCGAGAAATAAGGCTACTGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-495s21c1
Sequence:CCGGGAGGTCTTTCAAGAGTTGAAACTCGAGTTTCAACTCTTGAAAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-2285s21c1
Sequence:CCGGGCAAACTAAGTTGTGAAGCTACTCGAGTAGCTTCACAACTTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015475.3-541s21c1
Sequence:CCGGCCAAACCTCCAGCCAATATAACTCGAGTTATATTGGCTGGAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-495s1c1
Sequence:CCGGGAGGTCTTTCAAGAGTTGAAACTCGAGTTTCAACTCTTGAAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015475.2-1407s1c1
Sequence:CCGGCAGGACAATAGATACCAAGATCTCGAGATCTTGGTATCTATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2560s1c1
Sequence:CCGGCCCTTTATTATTGCTGCAGAACTCGAGTTCTGCAGCAATAATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2288s1c1
Sequence:CCGGGCAAACTAAGTTGTGAAGCTACTCGAGTAGCTTCACAACTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015475.2-2192s1c1
Sequence:CCGGGCACATTCAGTAGCCTTATTTCTCGAGAAATAAGGCTACTGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks