EMAIL THIS PAGE TO A FRIEND

FAM98B

family with sequence similarity 98, member B

70 Gene Product Result for
UniProtKB ID: Q52LJ0, A8MUW5, Q8N935
Gene ID:
Mouse(68215) family with sequence similarity 98, member B
Rat(499866) family with sequence similarity 98, member B
Zebrafish(780841) family with sequence similarity 98, member B
chicken(423291) family with sequence similarity 98, member B
cow(532711) family with sequence similarity 98, member B
domestic cat(101093362) family with sequence similarity 98, member B
dog(478254) family with sequence similarity 98, member B
domestic guinea pig(100734929) family with sequence similarity 98, member B
naked mole-rat(101700496) family with sequence similarity 98, member B
sheep(101105253) family with sequence similarity 98, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173611 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009881 MISSION® esiRNA esiRNA targeting human FAM98B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042429 Rosetta Predictions human pricing
NM_173611 Rosetta Predictions human pricing
XM_001080684 Rosetta Predictions rat pricing
XM_575208 Rosetta Predictions rat pricing
NM_026620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309728 predicted 527
2 SASI_Hs02_00309729 predicted 510
3 SASI_Hs02_00309730 predicted 517
4 SASI_Hs02_00309731 predicted 334
5 SASI_Hs02_00309732 predicted 705
6 SASI_Hs02_00309733 predicted 550
7 SASI_Hs02_00309734 predicted 312
8 SASI_Hs02_00309735 predicted 398
9 SASI_Hs02_00309736 predicted 498
10 SASI_Hs02_00309737 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064570 predicted 524
2 SASI_Hs02_00368471 predicted 511
3 SASI_Hs02_00368472 predicted 519
4 SASI_Hs02_00368473 predicted 335
5 SASI_Hs01_00064572 predicted 706
6 SASI_Hs02_00368474 predicted 552
7 SASI_Hs02_00368475 predicted 304
8 SASI_Hs01_00064577 predicted 393
9 SASI_Hs01_00064578 predicted 500
10 SASI_Hs01_00064579 predicted 477
11 SASI_Hs01_00064571 predicted 944
12 SASI_Hs01_00064573 predicted 806
13 SASI_Hs01_00064574 predicted 713
14 SASI_Hs01_00064575 predicted 721
15 SASI_Hs01_00064576 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368930 predicted 688
2 SASI_Rn02_00368931 predicted 515
3 SASI_Rn02_00368932 predicted 711
4 SASI_Rn02_00368933 predicted 725
5 SASI_Rn02_00368934 predicted 363
6 SASI_Rn02_00368935 predicted 603
7 SASI_Rn02_00368936 predicted 195
8 SASI_Rn02_00368937 predicted 246
9 SASI_Rn02_00368938 predicted 352
10 SASI_Rn02_00368939 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403277 predicted 690
2 SASI_Rn02_00403278 predicted 509
3 SASI_Rn02_00403279 predicted 712
4 SASI_Rn02_00403280 predicted 722
5 SASI_Rn02_00403281 predicted 360
6 SASI_Rn02_00403282 predicted 604
7 SASI_Rn02_00403283 predicted 197
8 SASI_Rn02_00403284 predicted 242
9 SASI_Rn02_00403285 predicted 356
10 SASI_Rn02_00403286 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151209 predicted 687
2 SASI_Mm01_00151210 predicted 706
3 SASI_Mm01_00151211 predicted 698
4 SASI_Mm01_00151212 predicted 724
5 SASI_Mm01_00151213 predicted 359
6 SASI_Mm01_00151214 predicted 606
7 SASI_Mm01_00151215 predicted 192
8 SASI_Mm01_00151216 predicted 365
9 SASI_Mm01_00151217 predicted 604
10 SASI_Mm01_00151218 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173611
VALIDATED
FAM98B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 98, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173611.1-670s1c1
Sequence:CCGGCGCCGACGAATGTTAATGAAACTCGAGTTTCATTAACATTCGTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-1154s1c1
Sequence:CCGGGCAAGAATTATGTTCCATCTTCTCGAGAAGATGGAACATAATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-845s1c1
Sequence:CCGGCCAAGATCATTAGGACAAGTACTCGAGTACTTGTCCTAATGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173611.1-2600s1c1
Sequence:CCGGCCAAATCAATGGCAATGGAAACTCGAGTTTCCATTGCCATTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-489s1c1
Sequence:CCGGCAAGTCAACAACTTCTGACATCTCGAGATGTCAGAAGTTGTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-1318s21c1
Sequence:CCGGGTGGATATAGAAGATACTAAACTCGAGTTTAGTATCTTCTATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-911s21c1
Sequence:CCGGGACCGCATGTGCCATTAATAACTCGAGTTATTAATGGCACATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-314s21c1
Sequence:CCGGTCCATATTCTGTACTCATATCCTCGAGGATATGAGTACAGAATATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173611
VALIDATED
FAM98B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 98, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173611.1-670s1c1
Sequence:CCGGCGCCGACGAATGTTAATGAAACTCGAGTTTCATTAACATTCGTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-1154s1c1
Sequence:CCGGGCAAGAATTATGTTCCATCTTCTCGAGAAGATGGAACATAATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-845s1c1
Sequence:CCGGCCAAGATCATTAGGACAAGTACTCGAGTACTTGTCCTAATGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173611.1-2600s1c1
Sequence:CCGGCCAAATCAATGGCAATGGAAACTCGAGTTTCCATTGCCATTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-489s1c1
Sequence:CCGGCAAGTCAACAACTTCTGACATCTCGAGATGTCAGAAGTTGTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-1318s21c1
Sequence:CCGGGTGGATATAGAAGATACTAAACTCGAGTTTAGTATCTTCTATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-911s21c1
Sequence:CCGGGACCGCATGTGCCATTAATAACTCGAGTTATTAATGGCACATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-314s21c1
Sequence:CCGGTCCATATTCTGTACTCATATCCTCGAGGATATGAGTACAGAATATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173611
VALIDATED
FAM98B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 98, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173611.1-670s1c1
Sequence:CCGGCGCCGACGAATGTTAATGAAACTCGAGTTTCATTAACATTCGTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-1154s1c1
Sequence:CCGGGCAAGAATTATGTTCCATCTTCTCGAGAAGATGGAACATAATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-845s1c1
Sequence:CCGGCCAAGATCATTAGGACAAGTACTCGAGTACTTGTCCTAATGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173611.1-2600s1c1
Sequence:CCGGCCAAATCAATGGCAATGGAAACTCGAGTTTCCATTGCCATTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173611.1-489s1c1
Sequence:CCGGCAAGTCAACAACTTCTGACATCTCGAGATGTCAGAAGTTGTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-1318s21c1
Sequence:CCGGGTGGATATAGAAGATACTAAACTCGAGTTTAGTATCTTCTATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-911s21c1
Sequence:CCGGGACCGCATGTGCCATTAATAACTCGAGTTATTAATGGCACATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173611.2-314s21c1
Sequence:CCGGTCCATATTCTGTACTCATATCCTCGAGGATATGAGTACAGAATATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026620
VALIDATED
FAM98B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 98, member B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1344s1c1
Sequence:CCGGGATAAAGTCCTTATGCAACCTCTCGAGAGGTTGCATAAGGACTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1402s1c1
Sequence:CCGGGAGAGCTTCCAGCTTGAGATACTCGAGTATCTCAAGCTGGAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1389s1c1
Sequence:CCGGGAGAGATGACCTAGAGAGCTTCTCGAGAAGCTCTCTAGGTCATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026620.1-1341s1c1
Sequence:CCGGCCAGATAAAGTCCTTATGCAACTCGAGTTGCATAAGGACTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-390s21c1
Sequence:CCGGAGTACAGAACTTCAAGCTTTACTCGAGTAAAGCTTGAAGTTCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-685s21c1
Sequence:CCGGAGTGTCGCCGACGGATGTTAACTCGAGTTAACATCCGTCGGCGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-608s21c1
Sequence:CCGGATTGCTAAAGGTTGATTTAAGCTCGAGCTTAAATCAACCTTTAGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026620
VALIDATED
FAM98B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 98, member B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1344s1c1
Sequence:CCGGGATAAAGTCCTTATGCAACCTCTCGAGAGGTTGCATAAGGACTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1402s1c1
Sequence:CCGGGAGAGCTTCCAGCTTGAGATACTCGAGTATCTCAAGCTGGAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1389s1c1
Sequence:CCGGGAGAGATGACCTAGAGAGCTTCTCGAGAAGCTCTCTAGGTCATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026620.1-1341s1c1
Sequence:CCGGCCAGATAAAGTCCTTATGCAACTCGAGTTGCATAAGGACTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-390s21c1
Sequence:CCGGAGTACAGAACTTCAAGCTTTACTCGAGTAAAGCTTGAAGTTCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-685s21c1
Sequence:CCGGAGTGTCGCCGACGGATGTTAACTCGAGTTAACATCCGTCGGCGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-608s21c1
Sequence:CCGGATTGCTAAAGGTTGATTTAAGCTCGAGCTTAAATCAACCTTTAGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026620
VALIDATED
FAM98B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 98, member B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1344s1c1
Sequence:CCGGGATAAAGTCCTTATGCAACCTCTCGAGAGGTTGCATAAGGACTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1402s1c1
Sequence:CCGGGAGAGCTTCCAGCTTGAGATACTCGAGTATCTCAAGCTGGAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026620.1-1389s1c1
Sequence:CCGGGAGAGATGACCTAGAGAGCTTCTCGAGAAGCTCTCTAGGTCATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026620.1-1341s1c1
Sequence:CCGGCCAGATAAAGTCCTTATGCAACTCGAGTTGCATAAGGACTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-390s21c1
Sequence:CCGGAGTACAGAACTTCAAGCTTTACTCGAGTAAAGCTTGAAGTTCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-685s21c1
Sequence:CCGGAGTGTCGCCGACGGATGTTAACTCGAGTTAACATCCGTCGGCGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026620.3-608s21c1
Sequence:CCGGATTGCTAAAGGTTGATTTAAGCTCGAGCTTAAATCAACCTTTAGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks