EMAIL THIS PAGE TO A FRIEND

FAM9A

family with sequence similarity 9, member A

49 Gene Product Result for
Synonyms: TEX39A
Species: Human FAM9A(171482)
UniProtKB ID: Q8IZU1, B7ZLH5, Q2M2D1
Gene ID:
Human(171482) Summary: This gene is a member of a gene family which arose through duplication on the X chromosome. The encoded protein may be a nuclear protein that is localized to the nucleolus, and has some similarity to a synaptonemal complex protein. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174951 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107171 MISSION® esiRNA esiRNA human FAM9A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174951 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175127 predicted 1175
2 SASI_Hs01_00175131 predicted 269
3 SASI_Hs01_00175132 predicted 1174
4 SASI_Hs01_00175133 predicted 1147
5 SASI_Hs01_00175134 predicted 199
6 SASI_Hs01_00175135 predicted 274
7 SASI_Hs01_00175126 predicted 310
8 SASI_Hs01_00175128 predicted 1154
9 SASI_Hs02_00368888 predicted 1167
10 SASI_Hs01_00175129 predicted 276
11 SASI_Hs01_00175130 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174951
FAM9A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 9, member A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-1014s1c1
Sequence:CCGGGAAGCCGCTACTTGAGCAATTCTCGAGAATTGCTCAAGTAGCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174951.2-1299s1c1
Sequence:CCGGCCTCTGTCACTTGTCTGTTAACTCGAGTTAACAGACAAGTGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-558s1c1
Sequence:CCGGGAACACAATTGAACGTGCTTTCTCGAGAAAGCACGTTCAATTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-1083s1c1
Sequence:CCGGCAGTGAAGAAAGTGAACTTGACTCGAGTCAAGTTCACTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174951
FAM9A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 9, member A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-1014s1c1
Sequence:CCGGGAAGCCGCTACTTGAGCAATTCTCGAGAATTGCTCAAGTAGCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174951.2-1299s1c1
Sequence:CCGGCCTCTGTCACTTGTCTGTTAACTCGAGTTAACAGACAAGTGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-558s1c1
Sequence:CCGGGAACACAATTGAACGTGCTTTCTCGAGAAAGCACGTTCAATTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-1083s1c1
Sequence:CCGGCAGTGAAGAAAGTGAACTTGACTCGAGTCAAGTTCACTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174951
FAM9A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 9, member A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-1014s1c1
Sequence:CCGGGAAGCCGCTACTTGAGCAATTCTCGAGAATTGCTCAAGTAGCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174951.2-1299s1c1
Sequence:CCGGCCTCTGTCACTTGTCTGTTAACTCGAGTTAACAGACAAGTGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-558s1c1
Sequence:CCGGGAACACAATTGAACGTGCTTTCTCGAGAAAGCACGTTCAATTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174951.2-1083s1c1
Sequence:CCGGCAGTGAAGAAAGTGAACTTGACTCGAGTCAAGTTCACTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks