EMAIL THIS PAGE TO A FRIEND

FAM9B

family with sequence similarity 9, member B

45 Gene Product Result for
Synonyms: TEX39B
UniProtKB ID: Q8IZU0, Q0IJ68
Gene ID:
Human(171483) Summary: This gene is a member of a gene family which arose through duplication on the X chromosome. The encoded protein may be localized to the nucleus as the protein contains several nuclear localization signals, and has similarity to a synaptonemal complex protein. [provided by RefSeq, Aug 2011]
Rat(100360496) family with sequence similarity 9, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205849 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123901 MISSION® esiRNA esiRNA human FAM9B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205849 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244210 predicted 972
2 SASI_Hs01_00244211 predicted 966
3 SASI_Hs01_00244212 predicted 979
4 SASI_Hs01_00244213 predicted 971
5 SASI_Hs01_00244214 predicted 961
6 SASI_Hs01_00244215 predicted 991
7 SASI_Hs01_00244216 predicted 658
8 SASI_Hs02_00373479 predicted 855
9 SASI_Hs01_00244217 predicted 904
10 SASI_Hs01_00244218 predicted 784
11 SASI_Hs01_00244219 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205849
FAM9B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 9, member B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-899s1c1
Sequence:CCGGGATGAAGACAGTGAACTTGATCTCGAGATCAAGTTCACTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-776s1c1
Sequence:CCGGCAGAAGAAGTGGCAACAATATCTCGAGATATTGTTGCCACTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-408s1c1
Sequence:CCGGGTGATGAATGTGAGGAAAGAACTCGAGTTCTTTCCTCACATTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-872s1c1
Sequence:CCGGGAAGACCTTTGTGACAGAGTTCTCGAGAACTCTGTCACAAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-839s1c1
Sequence:CCGGCGTGACCAATTCGTAAAGGCTCTCGAGAGCCTTTACGAATTGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-731s1c1
Sequence:CCGGGAAGAGGGAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTCCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-530s1c1
Sequence:CCGGCCAGAAGATACTGCAGAGGATCTCGAGATCCTCTGCAGTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-407s1c1
Sequence:CCGGCGTGATGAATGTGAGGAAAGACTCGAGTCTTTCCTCACATTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205849.2-636s21c1
Sequence:CCGGGAACTTGATAACTAGACATGTCTCGAGACATGTCTAGTTATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205849.2-389s21c1
Sequence:CCGGACATTCTCTGAAGTTGCTAAACTCGAGTTTAGCAACTTCAGAGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205849.2-851s21c1
Sequence:CCGGACTCGTCTGTTAAATGCCAGACTCGAGTCTGGCATTTAACAGACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205849
FAM9B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 9, member B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-899s1c1
Sequence:CCGGGATGAAGACAGTGAACTTGATCTCGAGATCAAGTTCACTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-776s1c1
Sequence:CCGGCAGAAGAAGTGGCAACAATATCTCGAGATATTGTTGCCACTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-408s1c1
Sequence:CCGGGTGATGAATGTGAGGAAAGAACTCGAGTTCTTTCCTCACATTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-872s1c1
Sequence:CCGGGAAGACCTTTGTGACAGAGTTCTCGAGAACTCTGTCACAAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-839s1c1
Sequence:CCGGCGTGACCAATTCGTAAAGGCTCTCGAGAGCCTTTACGAATTGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-731s1c1
Sequence:CCGGGAAGAGGGAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTCCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-530s1c1
Sequence:CCGGCCAGAAGATACTGCAGAGGATCTCGAGATCCTCTGCAGTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-407s1c1
Sequence:CCGGCGTGATGAATGTGAGGAAAGACTCGAGTCTTTCCTCACATTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205849.2-636s21c1
Sequence:CCGGGAACTTGATAACTAGACATGTCTCGAGACATGTCTAGTTATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205849.2-389s21c1
Sequence:CCGGACATTCTCTGAAGTTGCTAAACTCGAGTTTAGCAACTTCAGAGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205849.2-851s21c1
Sequence:CCGGACTCGTCTGTTAAATGCCAGACTCGAGTCTGGCATTTAACAGACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205849
FAM9B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 9, member B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-899s1c1
Sequence:CCGGGATGAAGACAGTGAACTTGATCTCGAGATCAAGTTCACTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-776s1c1
Sequence:CCGGCAGAAGAAGTGGCAACAATATCTCGAGATATTGTTGCCACTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-408s1c1
Sequence:CCGGGTGATGAATGTGAGGAAAGAACTCGAGTTCTTTCCTCACATTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-872s1c1
Sequence:CCGGGAAGACCTTTGTGACAGAGTTCTCGAGAACTCTGTCACAAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-839s1c1
Sequence:CCGGCGTGACCAATTCGTAAAGGCTCTCGAGAGCCTTTACGAATTGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-731s1c1
Sequence:CCGGGAAGAGGGAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTCCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205849.1-530s1c1
Sequence:CCGGCCAGAAGATACTGCAGAGGATCTCGAGATCCTCTGCAGTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205849.1-407s1c1
Sequence:CCGGCGTGATGAATGTGAGGAAAGACTCGAGTCTTTCCTCACATTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205849.2-636s21c1
Sequence:CCGGGAACTTGATAACTAGACATGTCTCGAGACATGTCTAGTTATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205849.2-389s21c1
Sequence:CCGGACATTCTCTGAAGTTGCTAAACTCGAGTTTAGCAACTTCAGAGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205849.2-851s21c1
Sequence:CCGGACTCGTCTGTTAAATGCCAGACTCGAGTCTGGCATTTAACAGACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks