EMAIL THIS PAGE TO A FRIEND

FAM9C

family with sequence similarity 9, member C

58 Gene Product Result for
Synonyms: TEX39C
Species: Human FAM9C(171484)
UniProtKB ID: Q8IZT9, B2R9G7, Q5HYJ6
Gene ID:
Human(171484) Summary: This gene is a member of a gene family which arose through duplication on the X chromosome. The encoded protein may be localized to the nucleus as the protein contains several nuclear localization signals, and has similarity to a synaptonemal complex protein. [provided by RefSeq, Aug 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174901 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174901 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368791 predicted 846
2 SASI_Hs02_00368792 predicted 863
3 SASI_Hs01_00073145 predicted 319
4 SASI_Hs02_00368793 predicted 239
5 SASI_Hs02_00368794 predicted 824
6 SASI_Hs02_00368795 predicted 854
7 SASI_Hs02_00368796 predicted 690
8 SASI_Hs02_00368797 predicted 264
9 SASI_Hs02_00368798 predicted 483
10 SASI_Hs02_00368799 predicted 487
11 SASI_Hs01_00073140 predicted 813
12 SASI_Hs01_00073141 predicted 822
13 SASI_Hs01_00073142 predicted 878
14 SASI_Hs01_00073143 predicted 929
15 SASI_Hs01_00073144 predicted 879
16 SASI_Hs01_00073146 predicted 800
17 SASI_Hs01_00073147 predicted 660
18 SASI_Hs01_00073148 predicted 737
19 SASI_Hs01_00073149 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174901
FAM9C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 9, member C
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-313s1c1
Sequence:CCGGGTTACAGAGACAAAGGAGGGACTCGAGTCCCTCCTTTGTCTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-394s1c1
Sequence:CCGGGTTGATACCAAGGAGCTAGAACTCGAGTTCTAGCTCCTTGGTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-601s1c1
Sequence:CCGGGATGAGCAGAAAGATGAGGAACTCGAGTTCCTCATCTTTCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-575s1c1
Sequence:CCGGCGAATGTCCTTGAAGAGTTCACTCGAGTGAACTCTTCAAGGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-485s1c1
Sequence:CCGGGCAGCGAAATAAAGAACAGAACTCGAGTTCTGTTCTTTATTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-401s1c1
Sequence:CCGGCCAAGGAGCTAGAAGATATTGCTCGAGCAATATCTTCTAGCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-283s1c1
Sequence:CCGGGTAAGTCATGAGCATGAGGAACTCGAGTTCCTCATGCTCATGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-607s1c1
Sequence:CCGGCAGAAAGATGAGGAAGGAGATCTCGAGATCTCCTTCCTCATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-319s1c1
Sequence:CCGGGAGACAAAGGAGGGAGATGTACTCGAGTACATCTCCCTCCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-277s1c1
Sequence:CCGGGATCCAGTAAGTCATGAGCATCTCGAGATGCTCATGACTTACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-685s1c1
Sequence:CCGGGATGGGAAAGGAACTGAAAGACTCGAGTCTTTCAGTTCCTTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-613s1c1
Sequence:CCGGGATGAGGAAGGAGATGGAGAACTCGAGTTCTCCATCTCCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174901
FAM9C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 9, member C
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-313s1c1
Sequence:CCGGGTTACAGAGACAAAGGAGGGACTCGAGTCCCTCCTTTGTCTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-394s1c1
Sequence:CCGGGTTGATACCAAGGAGCTAGAACTCGAGTTCTAGCTCCTTGGTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-601s1c1
Sequence:CCGGGATGAGCAGAAAGATGAGGAACTCGAGTTCCTCATCTTTCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-575s1c1
Sequence:CCGGCGAATGTCCTTGAAGAGTTCACTCGAGTGAACTCTTCAAGGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-485s1c1
Sequence:CCGGGCAGCGAAATAAAGAACAGAACTCGAGTTCTGTTCTTTATTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-401s1c1
Sequence:CCGGCCAAGGAGCTAGAAGATATTGCTCGAGCAATATCTTCTAGCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-283s1c1
Sequence:CCGGGTAAGTCATGAGCATGAGGAACTCGAGTTCCTCATGCTCATGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-607s1c1
Sequence:CCGGCAGAAAGATGAGGAAGGAGATCTCGAGATCTCCTTCCTCATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-319s1c1
Sequence:CCGGGAGACAAAGGAGGGAGATGTACTCGAGTACATCTCCCTCCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-277s1c1
Sequence:CCGGGATCCAGTAAGTCATGAGCATCTCGAGATGCTCATGACTTACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-685s1c1
Sequence:CCGGGATGGGAAAGGAACTGAAAGACTCGAGTCTTTCAGTTCCTTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-613s1c1
Sequence:CCGGGATGAGGAAGGAGATGGAGAACTCGAGTTCTCCATCTCCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174901
FAM9C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 9, member C
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-313s1c1
Sequence:CCGGGTTACAGAGACAAAGGAGGGACTCGAGTCCCTCCTTTGTCTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-394s1c1
Sequence:CCGGGTTGATACCAAGGAGCTAGAACTCGAGTTCTAGCTCCTTGGTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-601s1c1
Sequence:CCGGGATGAGCAGAAAGATGAGGAACTCGAGTTCCTCATCTTTCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-575s1c1
Sequence:CCGGCGAATGTCCTTGAAGAGTTCACTCGAGTGAACTCTTCAAGGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-485s1c1
Sequence:CCGGGCAGCGAAATAAAGAACAGAACTCGAGTTCTGTTCTTTATTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-401s1c1
Sequence:CCGGCCAAGGAGCTAGAAGATATTGCTCGAGCAATATCTTCTAGCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-283s1c1
Sequence:CCGGGTAAGTCATGAGCATGAGGAACTCGAGTTCCTCATGCTCATGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-607s1c1
Sequence:CCGGCAGAAAGATGAGGAAGGAGATCTCGAGATCTCCTTCCTCATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-319s1c1
Sequence:CCGGGAGACAAAGGAGGGAGATGTACTCGAGTACATCTCCCTCCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-277s1c1
Sequence:CCGGGATCCAGTAAGTCATGAGCATCTCGAGATGCTCATGACTTACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174901.2-685s1c1
Sequence:CCGGGATGGGAAAGGAACTGAAAGACTCGAGTCTTTCAGTTCCTTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174901.2-613s1c1
Sequence:CCGGGATGAGGAAGGAGATGGAGAACTCGAGTTCTCCATCTCCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks