EMAIL THIS PAGE TO A FRIEND

FAN1

FANCD2/FANCI-associated nuclease 1

72 Gene Product Result for
Synonyms: KIAA1018 KMIN MTMR15
UniProtKB ID: Q9Y2M0, A8K4M2, Q86WU8
Gene ID:
Human(22909) Summary: This gene encodes a member of the myotubularin-related class 1 cysteine-based protein tyrosine phosphatases. The encoded protein may be catalytically inactive. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2009]
Mouse(330554) FANCD2/FANCI-associated nuclease 1
Rat(309256) FANCD2/FANCI-associated nuclease 1
Zebrafish(565458) FANCD2/FANCI-associated nuclease 1
domestic cat(101085979) FANCD2/FANCI-associated nuclease 1
cow(508171) FANCD2/FANCI-associated nuclease 1
Horse(100059669) FANCD2/FANCI-associated nuclease 1
dog(479017) FANCD2/FANCI-associated nuclease 1
chicken(415383) FANCD2/FANCI-associated nuclease 1
domestic guinea pig(100716193) FANCD2/FANCI-associated nuclease 1
naked mole-rat(101722565) FANCD2/FANCI-associated nuclease 1
sheep(101118223) FANCD2/FANCI-associated nuclease 1
Domestic Rabbit(100345357) FANCD2/FANCI-associated nuclease 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014967 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_885802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_885802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_885802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014967 Rosetta Predictions human pricing
XM_001058546 Rosetta Predictions rat pricing
XM_219706 Rosetta Predictions rat pricing
XM_885802 Rosetta Predictions mouse pricing
XM_976717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238805 predicted 484
2 SASI_Hs01_00238806 predicted 601
3 SASI_Hs01_00238807 predicted 701
4 SASI_Hs01_00238808 predicted 1976
5 SASI_Hs01_00238809 predicted 335
6 SASI_Hs01_00238810 predicted 426
7 SASI_Hs01_00238811 predicted 1315
8 SASI_Hs02_00346676 predicted 1522
9 SASI_Hs01_00238813 predicted 2172
10 SASI_Hs01_00238814 predicted 761
11 SASI_Hs01_00238812 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290093 predicted 1295
2 SASI_Rn02_00290094 predicted 2138
3 SASI_Rn02_00290095 predicted 1287
4 SASI_Rn02_00290096 predicted 1122
5 SASI_Rn02_00290097 predicted 1560
6 SASI_Rn02_00290098 predicted 1891
7 SASI_Rn02_00290099 predicted 1038
8 SASI_Rn02_00290100 predicted 1379
9 SASI_Rn02_00290101 predicted 782
10 SASI_Rn02_00290102 predicted 2539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378609 predicted 1300
2 SASI_Rn02_00378610 predicted 2141
3 SASI_Rn02_00378611 predicted 1288
4 SASI_Rn02_00378612 predicted 1118
5 SASI_Rn02_00378613 predicted 1556
6 SASI_Rn02_00378614 predicted 1889
7 SASI_Rn02_00378615 predicted 1377
8 SASI_Rn02_00378616 predicted 2548
9 SASI_Rn02_00378617 predicted 1288
10 SASI_Rn02_00378618 predicted 2294
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246240 predicted 2729
2 SASI_Mm01_00246241 predicted 1513
3 SASI_Mm02_00428248 predicted 740
4 SASI_Mm01_00246242 predicted 1966
5 SASI_Mm02_00428249 predicted 760
6 SASI_Mm01_00246243 predicted 1712
7 SASI_Mm02_00428250 predicted 988
8 SASI_Mm01_00246245 predicted 3133
9 SASI_Mm01_00246247 predicted 1057
10 SASI_Mm01_00246248 predicted 1596
11 SASI_Mm01_00246239 predicted 1586
12 SASI_Mm01_00246244 predicted 1872
13 SASI_Mm01_00246246 predicted 1820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446065 predicted 2693
2 SASI_Mm02_00446066 predicted 705
3 SASI_Mm02_00446067 predicted 1016
4 SASI_Mm02_00446068 predicted 1930
5 SASI_Mm02_00446069 predicted 719
6 SASI_Mm02_00446070 predicted 1676
7 SASI_Mm02_00446071 predicted 941
8 SASI_Mm02_00446072 predicted 3093
9 SASI_Mm02_00446073 predicted 2725
10 SASI_Mm02_00446074 predicted 1245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014967
VALIDATED
FAN1 MISSION shRNA Bacterial Glycerol Stock
FANCD2/FANCI-associated nuclease 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-1423s1c1
Sequence:CCGGGCTCTTTGATGAGCAGGAGAACTCGAGTTCTCCTGCTCATCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014967.2-1040s1c1
Sequence:CCGGCCAGATTTCACTCTTAGGAATCTCGAGATTCCTAAGAGTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-519s1c1
Sequence:CCGGCCTTAGAAGATGTAACACCTACTCGAGTAGGTGTTACATCTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-3177s1c1
Sequence:CCGGCCAATGATCGTCTTTCACATACTCGAGTATGTGAAAGACGATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014967.2-4005s1c1
Sequence:CCGGGCTGTTACTATCAGCCTGAATCTCGAGATTCAGGCTGATAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014967.2-1700s1c1
Sequence:CCGGGCGAATCCCAATGGACAGAAACTCGAGTTTCTGTCCATTGGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014967.2-3146s1c1
Sequence:CCGGCGTCACTTTAAGCTGGTGGAACTCGAGTTCCACCAGCTTAAAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3637s21c1
Sequence:CCGGAGAGACACGTGGCAGAATAACCTCGAGGTTATTCTGCCACGTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-722s21c1
Sequence:CCGGATCGTAGTGTGAAAGTCATTTCTCGAGAAATGACTTTCACACTACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-3326s21c1
Sequence:CCGGAGAGCCAAAGCCTTAGCTAAACTCGAGTTTAGCTAAGGCTTTGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-1525s21c1
Sequence:CCGGGCTACTGGTCAGAAGTTATATCTCGAGATATAACTTCTGACCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3596s21c1
Sequence:CCGGCAGCGGAAGTAGCACAGTTTCCTCGAGGAAACTGTGCTACTTCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3795s21c1
Sequence:CCGGCACTGATGATTCCATTCTTTACTCGAGTAAAGAATGGAATCATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-855s21c1
Sequence:CCGGTGTTAAGAGCCTGATTGATAACTCGAGTTATCAATCAGGCTCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014967
VALIDATED
FAN1 MISSION shRNA shRNA Plasmid DNA
FANCD2/FANCI-associated nuclease 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-1423s1c1
Sequence:CCGGGCTCTTTGATGAGCAGGAGAACTCGAGTTCTCCTGCTCATCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014967.2-1040s1c1
Sequence:CCGGCCAGATTTCACTCTTAGGAATCTCGAGATTCCTAAGAGTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-519s1c1
Sequence:CCGGCCTTAGAAGATGTAACACCTACTCGAGTAGGTGTTACATCTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-3177s1c1
Sequence:CCGGCCAATGATCGTCTTTCACATACTCGAGTATGTGAAAGACGATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014967.2-4005s1c1
Sequence:CCGGGCTGTTACTATCAGCCTGAATCTCGAGATTCAGGCTGATAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014967.2-1700s1c1
Sequence:CCGGGCGAATCCCAATGGACAGAAACTCGAGTTTCTGTCCATTGGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014967.2-3146s1c1
Sequence:CCGGCGTCACTTTAAGCTGGTGGAACTCGAGTTCCACCAGCTTAAAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3637s21c1
Sequence:CCGGAGAGACACGTGGCAGAATAACCTCGAGGTTATTCTGCCACGTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-722s21c1
Sequence:CCGGATCGTAGTGTGAAAGTCATTTCTCGAGAAATGACTTTCACACTACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-3326s21c1
Sequence:CCGGAGAGCCAAAGCCTTAGCTAAACTCGAGTTTAGCTAAGGCTTTGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-1525s21c1
Sequence:CCGGGCTACTGGTCAGAAGTTATATCTCGAGATATAACTTCTGACCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3596s21c1
Sequence:CCGGCAGCGGAAGTAGCACAGTTTCCTCGAGGAAACTGTGCTACTTCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3795s21c1
Sequence:CCGGCACTGATGATTCCATTCTTTACTCGAGTAAAGAATGGAATCATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-855s21c1
Sequence:CCGGTGTTAAGAGCCTGATTGATAACTCGAGTTATCAATCAGGCTCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014967
VALIDATED
FAN1 MISSION shRNA Lentiviral Transduction Particles
FANCD2/FANCI-associated nuclease 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-1423s1c1
Sequence:CCGGGCTCTTTGATGAGCAGGAGAACTCGAGTTCTCCTGCTCATCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014967.2-1040s1c1
Sequence:CCGGCCAGATTTCACTCTTAGGAATCTCGAGATTCCTAAGAGTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-519s1c1
Sequence:CCGGCCTTAGAAGATGTAACACCTACTCGAGTAGGTGTTACATCTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014967.2-3177s1c1
Sequence:CCGGCCAATGATCGTCTTTCACATACTCGAGTATGTGAAAGACGATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014967.2-4005s1c1
Sequence:CCGGGCTGTTACTATCAGCCTGAATCTCGAGATTCAGGCTGATAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014967.2-1700s1c1
Sequence:CCGGGCGAATCCCAATGGACAGAAACTCGAGTTTCTGTCCATTGGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014967.2-3146s1c1
Sequence:CCGGCGTCACTTTAAGCTGGTGGAACTCGAGTTCCACCAGCTTAAAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3637s21c1
Sequence:CCGGAGAGACACGTGGCAGAATAACCTCGAGGTTATTCTGCCACGTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-722s21c1
Sequence:CCGGATCGTAGTGTGAAAGTCATTTCTCGAGAAATGACTTTCACACTACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-3326s21c1
Sequence:CCGGAGAGCCAAAGCCTTAGCTAAACTCGAGTTTAGCTAAGGCTTTGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-1525s21c1
Sequence:CCGGGCTACTGGTCAGAAGTTATATCTCGAGATATAACTTCTGACCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3596s21c1
Sequence:CCGGCAGCGGAAGTAGCACAGTTTCCTCGAGGAAACTGTGCTACTTCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014967.4-3795s21c1
Sequence:CCGGCACTGATGATTCCATTCTTTACTCGAGTAAAGAATGGAATCATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014967.4-855s21c1
Sequence:CCGGTGTTAAGAGCCTGATTGATAACTCGAGTTATCAATCAGGCTCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_885802
FAN1 MISSION shRNA Bacterial Glycerol Stock
FANCD2/FANCI-associated nuclease 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1856s21c1
Sequence:CCGGAGGCTCTTTCAACGTAAATTACTCGAGTAATTTACGTTGAAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-817s21c1
Sequence:CCGGGCCTGCTCAGGCTGGATTAATCTCGAGATTAATCCAGCCTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1393s21c1
Sequence:CCGGTCTCGTCAGTAACACGAAATCCTCGAGGATTTCGTGTTACTGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1073s21c1
Sequence:CCGGAGACGATACTTAAACGCTAAACTCGAGTTTAGCGTTTAAGTATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1049s21c1
Sequence:CCGGGGAAGTCTGACATCGAAATTGCTCGAGCAATTTCGATGTCAGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_885802
FAN1 MISSION shRNA shRNA Plasmid DNA
FANCD2/FANCI-associated nuclease 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1856s21c1
Sequence:CCGGAGGCTCTTTCAACGTAAATTACTCGAGTAATTTACGTTGAAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-817s21c1
Sequence:CCGGGCCTGCTCAGGCTGGATTAATCTCGAGATTAATCCAGCCTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1393s21c1
Sequence:CCGGTCTCGTCAGTAACACGAAATCCTCGAGGATTTCGTGTTACTGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1073s21c1
Sequence:CCGGAGACGATACTTAAACGCTAAACTCGAGTTTAGCGTTTAAGTATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1049s21c1
Sequence:CCGGGGAAGTCTGACATCGAAATTGCTCGAGCAATTTCGATGTCAGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_885802
FAN1 MISSION shRNA Lentiviral Transduction Particles
FANCD2/FANCI-associated nuclease 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1856s21c1
Sequence:CCGGAGGCTCTTTCAACGTAAATTACTCGAGTAATTTACGTTGAAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-817s21c1
Sequence:CCGGGCCTGCTCAGGCTGGATTAATCTCGAGATTAATCCAGCCTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1393s21c1
Sequence:CCGGTCTCGTCAGTAACACGAAATCCTCGAGGATTTCGTGTTACTGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1073s21c1
Sequence:CCGGAGACGATACTTAAACGCTAAACTCGAGTTTAGCGTTTAAGTATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885802.2-1049s21c1
Sequence:CCGGGGAAGTCTGACATCGAAATTGCTCGAGCAATTTCGATGTCAGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks