EMAIL THIS PAGE TO A FRIEND

FANCA

Fanconi anemia, complementation group A

108 Gene Product Result for
Synonyms: FA FA-H FA1 FAA FACA FAH FANCH
Gene ID:
Human(2175) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
Mouse(14087) Fanconi anemia, complementation group A
Rat(361435) Fanconi anemia, complementation group A
sheep(101111995) Fanconi anemia, complementation group A
naked mole-rat(101700504) Fanconi anemia, complementation group A
domestic guinea pig(100732330) Fanconi anemia, complementation group A
Zebrafish(692125) Fanconi anemia, complementation group A
chicken(415854) Fanconi anemia, complementation group A
domestic cat(101081431) Fanconi anemia, complementation group A
cow(618375) Fanconi anemia, complementation group A
Horse(100052495) Fanconi anemia, complementation group A
dog(608713) Fanconi anemia, complementation group A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000135 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064381 MISSION® esiRNA esiRNA human FANCA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000135 Rosetta Predictions human pricing
NM_001018112 Rosetta Predictions human pricing
NM_001108455 Rosetta Predictions rat pricing
NM_016925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082125 predicted 535
2 SASI_Hs01_00082126 predicted 292
3 SASI_Hs01_00082127 predicted 300
4 SASI_Hs01_00082128 predicted 259
5 SASI_Hs01_00082129 predicted 658
6 SASI_Hs01_00082130 predicted 489
7 SASI_Hs01_00082131 predicted 266
8 SASI_Hs01_00082132 predicted 477
9 SASI_Hs02_00301943 predicted 317
10 SASI_Hs01_00082133 predicted 292
11 SASI_Hs01_00082124 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094705 predicted 538
2 SASI_Hs01_00094706 predicted 298
3 SASI_Hs01_00094707 predicted 293
4 SASI_Hs01_00094708 predicted 252
5 SASI_Hs01_00094709 predicted 661
6 SASI_Hs01_00094710 predicted 492
7 SASI_Hs01_00094711 predicted 267
8 SASI_Hs01_00094712 predicted 480
9 SASI_Hs01_00094713 predicted 319
10 SASI_Hs02_00307029 predicted 293
11 SASI_Hs01_00094704 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238809 predicted 1906
2 SASI_Rn02_00238810 predicted 3382
3 SASI_Rn02_00238811 predicted 903
4 SASI_Rn02_00238812 predicted 3667
5 SASI_Rn02_00238813 predicted 879
6 SASI_Rn02_00238814 predicted 1629
7 SASI_Rn02_00238815 predicted 3844
8 SASI_Rn02_00238816 predicted 3515
9 SASI_Rn02_00238817 predicted 3317
10 SASI_Rn02_00238818 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065175 predicted 2859
2 SASI_Mm01_00065176 predicted 3384
3 SASI_Mm01_00065177 predicted 1464
4 SASI_Mm01_00065178 predicted 3476
5 SASI_Mm01_00065179 predicted 1008
6 SASI_Mm01_00065180 predicted 362
7 SASI_Mm01_00065182 predicted 1990
8 SASI_Mm01_00065183 predicted 3134
9 SASI_Mm02_00323787 predicted 1825
10 SASI_Mm02_00323788 predicted 3040
11 SASI_Mm01_00065174 predicted 1336
12 SASI_Mm01_00065181 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016925
VALIDATED
FANCA MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016925.2-3610s21c1
Sequence:CCGGCCCGGGAATTTGCTAGCAATTCTCGAGAATTGCTAGCAAATTCCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016925.2-2013s21c1
Sequence:CCGGCCGACCCAATACAGTGTTATTCTCGAGAATAACACTGTATTGGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016925.2-4345s21c1
Sequence:CCGGTGCACCCATCTCAGCGCACCACTCGAGTGGTGCGCTGAGATGGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-4347s1c1
Sequence:CCGGTGCACCCATCTCAGCGCACCACTCGAGTGGTGCGCTGAGATGGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-3612s1c1
Sequence:CCGGCCCGGGAATTTGCTAGCAATTCTCGAGAATTGCTAGCAAATTCCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016925.1-1472s1c1
Sequence:CCGGCGGTACATGCAGGTGCATATTCTCGAGAATATGCACCTGCATGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-2980s1c1
Sequence:CCGGCCACCAAAGTTCGAGGAGTTACTCGAGTAACTCCTCGAACTTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016925.1-2015s1c1
Sequence:CCGGCCGACCCAATACAGTGTTATTCTCGAGAATAACACTGTATTGGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016925
VALIDATED
FANCA MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016925.2-3610s21c1
Sequence:CCGGCCCGGGAATTTGCTAGCAATTCTCGAGAATTGCTAGCAAATTCCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016925.2-2013s21c1
Sequence:CCGGCCGACCCAATACAGTGTTATTCTCGAGAATAACACTGTATTGGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016925.2-4345s21c1
Sequence:CCGGTGCACCCATCTCAGCGCACCACTCGAGTGGTGCGCTGAGATGGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-4347s1c1
Sequence:CCGGTGCACCCATCTCAGCGCACCACTCGAGTGGTGCGCTGAGATGGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-3612s1c1
Sequence:CCGGCCCGGGAATTTGCTAGCAATTCTCGAGAATTGCTAGCAAATTCCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016925.1-1472s1c1
Sequence:CCGGCGGTACATGCAGGTGCATATTCTCGAGAATATGCACCTGCATGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-2980s1c1
Sequence:CCGGCCACCAAAGTTCGAGGAGTTACTCGAGTAACTCCTCGAACTTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016925.1-2015s1c1
Sequence:CCGGCCGACCCAATACAGTGTTATTCTCGAGAATAACACTGTATTGGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016925
VALIDATED
FANCA MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016925.2-3610s21c1
Sequence:CCGGCCCGGGAATTTGCTAGCAATTCTCGAGAATTGCTAGCAAATTCCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016925.2-2013s21c1
Sequence:CCGGCCGACCCAATACAGTGTTATTCTCGAGAATAACACTGTATTGGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016925.2-4345s21c1
Sequence:CCGGTGCACCCATCTCAGCGCACCACTCGAGTGGTGCGCTGAGATGGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-4347s1c1
Sequence:CCGGTGCACCCATCTCAGCGCACCACTCGAGTGGTGCGCTGAGATGGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-3612s1c1
Sequence:CCGGCCCGGGAATTTGCTAGCAATTCTCGAGAATTGCTAGCAAATTCCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016925.1-1472s1c1
Sequence:CCGGCGGTACATGCAGGTGCATATTCTCGAGAATATGCACCTGCATGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016925.1-2980s1c1
Sequence:CCGGCCACCAAAGTTCGAGGAGTTACTCGAGTAACTCCTCGAACTTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016925.1-2015s1c1
Sequence:CCGGCCGACCCAATACAGTGTTATTCTCGAGAATAACACTGTATTGGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000135
VALIDATED
FANCA MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-2619s21c1
Sequence:CCGGCTTATCTCCAGGCCTTATTAACTCGAGTTAATAAGGCCTGGAGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-1834s21c1
Sequence:CCGGGACTCCCGTGTGGCGTTTATACTCGAGTATAAACGCCACACGGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-1597s21c1
Sequence:CCGGGCCGACCTCAAGGTTTCTATACTCGAGTATAGAAACCTTGAGGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-562s21c1
Sequence:CCGGCAGAGTTCTTTGTTGCTTGAACTCGAGTTCAAGCAACAAAGAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-301s21c1
Sequence:CCGGGCTAATCATTCTAGTTCATTTCTCGAGAAATGAACTAGAATGATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-1586s1c1
Sequence:CCGGGCCGACCTCAAGGTTTCTATACTCGAGTATAGAAACCTTGAGGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-3063s1c1
Sequence:CCGGGCACAGGAAATGAGGATATTACTCGAGTAATATCCTCATTTCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000135.1-3716s1c1
Sequence:CCGGGCACTGCACTTTGCGATTCAACTCGAGTTGAATCGCAAAGTGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-3253s1c1
Sequence:CCGGGCTGCTAATGTACAAACGGATCTCGAGATCCGTTTGTACATTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-551s1c1
Sequence:CCGGCAGAGTTCTTTGTTGCTTGAACTCGAGTTCAAGCAACAAAGAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000135
VALIDATED
FANCA MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-2619s21c1
Sequence:CCGGCTTATCTCCAGGCCTTATTAACTCGAGTTAATAAGGCCTGGAGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-1834s21c1
Sequence:CCGGGACTCCCGTGTGGCGTTTATACTCGAGTATAAACGCCACACGGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-1597s21c1
Sequence:CCGGGCCGACCTCAAGGTTTCTATACTCGAGTATAGAAACCTTGAGGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-562s21c1
Sequence:CCGGCAGAGTTCTTTGTTGCTTGAACTCGAGTTCAAGCAACAAAGAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-301s21c1
Sequence:CCGGGCTAATCATTCTAGTTCATTTCTCGAGAAATGAACTAGAATGATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-1586s1c1
Sequence:CCGGGCCGACCTCAAGGTTTCTATACTCGAGTATAGAAACCTTGAGGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-3063s1c1
Sequence:CCGGGCACAGGAAATGAGGATATTACTCGAGTAATATCCTCATTTCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000135.1-3716s1c1
Sequence:CCGGGCACTGCACTTTGCGATTCAACTCGAGTTGAATCGCAAAGTGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-3253s1c1
Sequence:CCGGGCTGCTAATGTACAAACGGATCTCGAGATCCGTTTGTACATTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-551s1c1
Sequence:CCGGCAGAGTTCTTTGTTGCTTGAACTCGAGTTCAAGCAACAAAGAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000135
VALIDATED
FANCA MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-2619s21c1
Sequence:CCGGCTTATCTCCAGGCCTTATTAACTCGAGTTAATAAGGCCTGGAGATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-1834s21c1
Sequence:CCGGGACTCCCGTGTGGCGTTTATACTCGAGTATAAACGCCACACGGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-1597s21c1
Sequence:CCGGGCCGACCTCAAGGTTTCTATACTCGAGTATAGAAACCTTGAGGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-562s21c1
Sequence:CCGGCAGAGTTCTTTGTTGCTTGAACTCGAGTTCAAGCAACAAAGAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000135.2-301s21c1
Sequence:CCGGGCTAATCATTCTAGTTCATTTCTCGAGAAATGAACTAGAATGATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-1586s1c1
Sequence:CCGGGCCGACCTCAAGGTTTCTATACTCGAGTATAGAAACCTTGAGGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-3063s1c1
Sequence:CCGGGCACAGGAAATGAGGATATTACTCGAGTAATATCCTCATTTCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000135.1-3716s1c1
Sequence:CCGGGCACTGCACTTTGCGATTCAACTCGAGTTGAATCGCAAAGTGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-3253s1c1
Sequence:CCGGGCTGCTAATGTACAAACGGATCTCGAGATCCGTTTGTACATTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000135.1-551s1c1
Sequence:CCGGCAGAGTTCTTTGTTGCTTGAACTCGAGTTCAAGCAACAAAGAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)