EMAIL THIS PAGE TO A FRIEND

FANCB

Fanconi anemia, complementation group B

72 Gene Product Result for
Synonyms: FA2 FAAP90 FAAP95 FAB FACB
UniProtKB ID: Q8NB91, B2RMZ4, Q7Z2U2, Q86XG1
Gene ID:
Human(2187) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group B. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(237211) Fanconi anemia, complementation group B
Rat(501552) Fanconi anemia, complementation group B
Zebrafish(692126) Fanconi anemia, complementation group B
cow(616549) Fanconi anemia, complementation group B
Horse(100055607) Fanconi anemia, complementation group B
domestic cat(101093751) Fanconi anemia, complementation group B
dog(100687493) Fanconi anemia, complementation group B
chicken(418628) Fanconi anemia, complementation group B
domestic guinea pig(100714814) Fanconi anemia, complementation group B
naked mole-rat(101721282) Fanconi anemia, complementation group B
sheep(101123188) Fanconi anemia, complementation group B
Domestic Rabbit(100355151) Fanconi anemia, complementation group B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152633 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018113 Rosetta Predictions human pricing
NM_152633 Rosetta Predictions human pricing
XM_001067159 Rosetta Predictions rat pricing
XM_576954 Rosetta Predictions rat pricing
NM_175027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041902 predicted 1874
2 SASI_Hs01_00041904 predicted 916
3 SASI_Hs01_00041905 predicted 1018
4 SASI_Hs01_00041906 predicted 1033
5 SASI_Hs01_00041907 predicted 1275
6 SASI_Hs01_00041908 predicted 1009
7 SASI_Hs02_00307030 predicted 1984
8 SASI_Hs01_00041909 predicted 854
9 SASI_Hs01_00041910 predicted 1765
10 SASI_Hs02_00307031 predicted 1592
11 SASI_Hs01_00041903 predicted 2056
12 SASI_Hs01_00041911 predicted 2475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156289 predicted 1751
2 SASI_Hs01_00156291 predicted 800
3 SASI_Hs01_00156292 predicted 898
4 SASI_Hs01_00156293 predicted 903
5 SASI_Hs01_00156294 predicted 1150
6 SASI_Hs01_00156295 predicted 897
7 SASI_Hs02_00366499 predicted 1856
8 SASI_Hs01_00156296 predicted 733
9 SASI_Hs01_00156297 predicted 1649
10 SASI_Hs02_00366500 predicted 1466
11 SASI_Hs01_00156290 predicted 1931
12 SASI_Hs01_00156298 predicted 2347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320057 predicted 1587
2 SASI_Rn02_00320058 predicted 1914
3 SASI_Rn02_00320059 predicted 2097
4 SASI_Rn02_00320060 predicted 2621
5 SASI_Rn02_00320061 predicted 1128
6 SASI_Rn02_00320062 predicted 2016
7 SASI_Rn02_00320063 predicted 1524
8 SASI_Rn02_00320064 predicted 1767
9 SASI_Rn02_00320065 predicted 1266
10 SASI_Rn02_00320066 predicted 2683
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405998 predicted 1580
2 SASI_Rn02_00405999 predicted 1914
3 SASI_Rn02_00406000 predicted 2097
4 SASI_Rn02_00406001 predicted 1125
5 SASI_Rn02_00406002 predicted 2013
6 SASI_Rn02_00406003 predicted 1531
7 SASI_Rn02_00406004 predicted 1772
8 SASI_Rn02_00406005 predicted 1262
9 SASI_Rn02_00406006 predicted 1257
10 SASI_Rn02_00406007 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144619 predicted 1149
2 SASI_Mm01_00144620 predicted 946
3 SASI_Mm01_00144622 predicted 429
4 SASI_Mm01_00144623 predicted 2058
5 SASI_Mm01_00144624 predicted 687
6 SASI_Mm01_00144625 predicted 1139
7 SASI_Mm01_00144626 predicted 1827
8 SASI_Mm01_00144627 predicted 1645
9 SASI_Mm01_00144628 predicted 643
10 SASI_Mm02_00345623 predicted 2085
11 SASI_Mm01_00144621 predicted 1607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175027
FANCB MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-513s1c1
Sequence:CCGGGAAGCACCTTAATATGACAGTCTCGAGACTGTCATATTAAGGTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.2-576s1c1
Sequence:CCGGGATTCAGTTGAAATCAGACCTCTCGAGAGGTCTGATTTCAACTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-580s1c1
Sequence:CCGGCAGTTGAAATCAGACCTCATTCTCGAGAATGAGGTCTGATTTCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-516s1c1
Sequence:CCGGGCACCTTAATATGACAGTAAACTCGAGTTTACTGTCATATTAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-493s1c1
Sequence:CCGGGTTCAGAGAGAAAGGATACTGCTCGAGCAGTATCCTTTCTCTCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-1682s1c1
Sequence:CCGGGAATCTAATGAGATGACTTTACTCGAGTAAAGTCATCTCATTAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-2117s1c1
Sequence:CCGGGATAATAGGGCCATGACATTTCTCGAGAAATGTCATGGCCCTATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-747s1c1
Sequence:CCGGCAGAACCATCTGAGGATAAATCTCGAGATTTATCCTCAGATGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-960s1c1
Sequence:CCGGCTCGAAAGAATCAGCTCATTTCTCGAGAAATGAGCTGATTCTTTCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175027
FANCB MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-513s1c1
Sequence:CCGGGAAGCACCTTAATATGACAGTCTCGAGACTGTCATATTAAGGTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.2-576s1c1
Sequence:CCGGGATTCAGTTGAAATCAGACCTCTCGAGAGGTCTGATTTCAACTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-580s1c1
Sequence:CCGGCAGTTGAAATCAGACCTCATTCTCGAGAATGAGGTCTGATTTCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-516s1c1
Sequence:CCGGGCACCTTAATATGACAGTAAACTCGAGTTTACTGTCATATTAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-493s1c1
Sequence:CCGGGTTCAGAGAGAAAGGATACTGCTCGAGCAGTATCCTTTCTCTCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-1682s1c1
Sequence:CCGGGAATCTAATGAGATGACTTTACTCGAGTAAAGTCATCTCATTAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-2117s1c1
Sequence:CCGGGATAATAGGGCCATGACATTTCTCGAGAAATGTCATGGCCCTATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-747s1c1
Sequence:CCGGCAGAACCATCTGAGGATAAATCTCGAGATTTATCCTCAGATGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-960s1c1
Sequence:CCGGCTCGAAAGAATCAGCTCATTTCTCGAGAAATGAGCTGATTCTTTCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175027
FANCB MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-513s1c1
Sequence:CCGGGAAGCACCTTAATATGACAGTCTCGAGACTGTCATATTAAGGTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.2-576s1c1
Sequence:CCGGGATTCAGTTGAAATCAGACCTCTCGAGAGGTCTGATTTCAACTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-580s1c1
Sequence:CCGGCAGTTGAAATCAGACCTCATTCTCGAGAATGAGGTCTGATTTCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-516s1c1
Sequence:CCGGGCACCTTAATATGACAGTAAACTCGAGTTTACTGTCATATTAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175027.2-493s1c1
Sequence:CCGGGTTCAGAGAGAAAGGATACTGCTCGAGCAGTATCCTTTCTCTCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-1682s1c1
Sequence:CCGGGAATCTAATGAGATGACTTTACTCGAGTAAAGTCATCTCATTAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-2117s1c1
Sequence:CCGGGATAATAGGGCCATGACATTTCTCGAGAAATGTCATGGCCCTATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-747s1c1
Sequence:CCGGCAGAACCATCTGAGGATAAATCTCGAGATTTATCCTCAGATGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175027.3-960s1c1
Sequence:CCGGCTCGAAAGAATCAGCTCATTTCTCGAGAAATGAGCTGATTCTTTCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152633
FANCB MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2543s1c1
Sequence:CCGGCGGCTGCTTTATCAGACAGAACTCGAGTTCTGTCTGATAAAGCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-1075s1c1
Sequence:CCGGGCTGTATGGAAAGAGAGCTTTCTCGAGAAAGCTCTCTTTCCATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2645s1c1
Sequence:CCGGCCCTTTACAGAGAAATAACTTCTCGAGAAGTTATTTCTCTGTAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-713s1c1
Sequence:CCGGGTTGTTTATCTGAGGAAGAATCTCGAGATTCTTCCTCAGATAAACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-897s1c1
Sequence:CCGGCCAGTTAAGAATATCTCTCATCTCGAGATGAGAGATATTCTTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2095s1c1
Sequence:CCGGGCACTTCTTGCAGCATTCCATCTCGAGATGGAATGCTGCAAGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152633
FANCB MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2543s1c1
Sequence:CCGGCGGCTGCTTTATCAGACAGAACTCGAGTTCTGTCTGATAAAGCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-1075s1c1
Sequence:CCGGGCTGTATGGAAAGAGAGCTTTCTCGAGAAAGCTCTCTTTCCATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2645s1c1
Sequence:CCGGCCCTTTACAGAGAAATAACTTCTCGAGAAGTTATTTCTCTGTAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-713s1c1
Sequence:CCGGGTTGTTTATCTGAGGAAGAATCTCGAGATTCTTCCTCAGATAAACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-897s1c1
Sequence:CCGGCCAGTTAAGAATATCTCTCATCTCGAGATGAGAGATATTCTTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2095s1c1
Sequence:CCGGGCACTTCTTGCAGCATTCCATCTCGAGATGGAATGCTGCAAGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152633
FANCB MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2543s1c1
Sequence:CCGGCGGCTGCTTTATCAGACAGAACTCGAGTTCTGTCTGATAAAGCAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-1075s1c1
Sequence:CCGGGCTGTATGGAAAGAGAGCTTTCTCGAGAAAGCTCTCTTTCCATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2645s1c1
Sequence:CCGGCCCTTTACAGAGAAATAACTTCTCGAGAAGTTATTTCTCTGTAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-713s1c1
Sequence:CCGGGTTGTTTATCTGAGGAAGAATCTCGAGATTCTTCCTCAGATAAACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-897s1c1
Sequence:CCGGCCAGTTAAGAATATCTCTCATCTCGAGATGAGAGATATTCTTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152633.2-2095s1c1
Sequence:CCGGGCACTTCTTGCAGCATTCCATCTCGAGATGGAATGCTGCAAGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)