EMAIL THIS PAGE TO A FRIEND

FANCC

Fanconi anemia, complementation group C

111 Gene Product Result for
Synonyms: FA3 FAC FACC
UniProtKB ID: Q00597, B1ALR8
Gene ID:
Human(2176) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group C. [provided by RefSeq, Jul 2008]
Mouse(14088) Fanconi anemia, complementation group C
Rat(24361) Fanconi anemia, complementation group C
sheep(101112700) Fanconi anemia, complementation group C
Domestic Rabbit(100344788) Fanconi anemia, complementation group C
naked mole-rat(101710421) Fanconi anemia, complementation group C
domestic guinea pig(100728880) Fanconi anemia, complementation group C
Zebrafish(692127) Fanconi anemia, complementation group C
cow(281762) Fanconi anemia, complementation group C
Horse(100061359) Fanconi anemia, complementation group C
domestic cat(101088370) Fanconi anemia, complementation group C
dog(607277) Fanconi anemia, complementation group C
chicken(427468) Fanconi anemia, complementation group C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000136 Rosetta Predictions human pricing
NM_012557 Rosetta Predictions rat pricing
NM_001042673 Rosetta Predictions mouse pricing
NM_007985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301944 predicted 819
2 SASI_Hs01_00234876 predicted 1806
3 SASI_Hs01_00234877 predicted 592
4 SASI_Hs02_00301945 predicted 1181
5 SASI_Hs01_00234878 predicted 1202
6 SASI_Hs01_00234879 predicted 811
7 SASI_Hs01_00234880 predicted 690
8 SASI_Hs01_00234881 predicted 658
9 SASI_Hs01_00234882 predicted 310
10 SASI_Hs01_00234883 predicted 1847
11 SASI_Hs01_00234884 predicted 1275
12 SASI_Hs01_00234885 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067611 predicted 375
2 SASI_Rn01_00067612 predicted 856
3 SASI_Rn01_00067613 predicted 1576
4 SASI_Rn01_00067614 predicted 397
5 SASI_Rn01_00067615 predicted 1620
6 SASI_Rn01_00067616 predicted 460
7 SASI_Rn01_00067617 predicted 585
8 SASI_Rn02_00259667 predicted 438
9 SASI_Rn01_00067620 predicted 691
10 SASI_Rn02_00259668 predicted 571
11 SASI_Rn01_00067618 predicted 1161
12 SASI_Rn01_00067619 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290925 predicted 879
2 SASI_Mm02_00290926 predicted 696
3 SASI_Mm02_00290927 predicted 545
4 SASI_Mm02_00290928 predicted 746
5 SASI_Mm02_00290929 predicted 1162
6 SASI_Mm02_00290930 predicted 763
7 SASI_Mm02_00290931 predicted 1551
8 SASI_Mm02_00290932 predicted 862
9 SASI_Mm02_00290933 predicted 632
10 SASI_Mm02_00290934 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135164 predicted 871
2 SASI_Mm01_00135165 predicted 702
3 SASI_Mm02_00312894 predicted 550
4 SASI_Mm01_00135166 predicted 740
5 SASI_Mm01_00135168 predicted 1160
6 SASI_Mm01_00135170 predicted 758
7 SASI_Mm01_00135171 predicted 1554
8 SASI_Mm01_00135173 predicted 860
9 SASI_Mm02_00312895 predicted 628
10 SASI_Mm02_00312896 predicted 610
11 SASI_Mm01_00135167 predicted 2028
12 SASI_Mm01_00135169 predicted 664
13 SASI_Mm01_00135172 predicted 1884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000136
FANCC MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000136.2-816s21c1
Sequence:CCGGGAGTTTGTGTCCCACTTATTACTCGAGTAATAAGTGGGACACAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000136.2-2315s21c1
Sequence:CCGGATTTGGTCATGAACCATTAAACTCGAGTTTAATGGTTCATGACCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000136.2-2267s21c1
Sequence:CCGGTCAAGCTGCACATCTATTATTCTCGAGAATAATAGATGTGCAGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1179s1c1
Sequence:CCGGCCTGGAAATCATAGCCACTATCTCGAGATAGTGGCTATGATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-590s1c1
Sequence:CCGGCCTGGATACAGGGTGTATTATCTCGAGATAATACACCCTGTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1810s1c1
Sequence:CCGGCACGAGATCATTGGCTTTCTTCTCGAGAAGAAAGCCAATGATCTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1046s1c1
Sequence:CCGGGTGAGAGAAATTGTCTGAGAACTCGAGTTCTCAGACAATTTCTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-808s1c1
Sequence:CCGGCGAGTTTGTGTCCCACTTATTCTCGAGAATAAGTGGGACACAAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000136
FANCC MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000136.2-816s21c1
Sequence:CCGGGAGTTTGTGTCCCACTTATTACTCGAGTAATAAGTGGGACACAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000136.2-2315s21c1
Sequence:CCGGATTTGGTCATGAACCATTAAACTCGAGTTTAATGGTTCATGACCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000136.2-2267s21c1
Sequence:CCGGTCAAGCTGCACATCTATTATTCTCGAGAATAATAGATGTGCAGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1179s1c1
Sequence:CCGGCCTGGAAATCATAGCCACTATCTCGAGATAGTGGCTATGATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-590s1c1
Sequence:CCGGCCTGGATACAGGGTGTATTATCTCGAGATAATACACCCTGTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1810s1c1
Sequence:CCGGCACGAGATCATTGGCTTTCTTCTCGAGAAGAAAGCCAATGATCTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1046s1c1
Sequence:CCGGGTGAGAGAAATTGTCTGAGAACTCGAGTTCTCAGACAATTTCTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-808s1c1
Sequence:CCGGCGAGTTTGTGTCCCACTTATTCTCGAGAATAAGTGGGACACAAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000136
FANCC MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000136.2-816s21c1
Sequence:CCGGGAGTTTGTGTCCCACTTATTACTCGAGTAATAAGTGGGACACAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000136.2-2315s21c1
Sequence:CCGGATTTGGTCATGAACCATTAAACTCGAGTTTAATGGTTCATGACCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000136.2-2267s21c1
Sequence:CCGGTCAAGCTGCACATCTATTATTCTCGAGAATAATAGATGTGCAGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1179s1c1
Sequence:CCGGCCTGGAAATCATAGCCACTATCTCGAGATAGTGGCTATGATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-590s1c1
Sequence:CCGGCCTGGATACAGGGTGTATTATCTCGAGATAATACACCCTGTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1810s1c1
Sequence:CCGGCACGAGATCATTGGCTTTCTTCTCGAGAAGAAAGCCAATGATCTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-1046s1c1
Sequence:CCGGGTGAGAGAAATTGTCTGAGAACTCGAGTTCTCAGACAATTTCTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000136.1-808s1c1
Sequence:CCGGCGAGTTTGTGTCCCACTTATTCTCGAGAATAAGTGGGACACAAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007985
VALIDATED
FANCC MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-2500s21c1
Sequence:CCGGTGCTTCCCTATGTCTAGTAAACTCGAGTTTACTAGACATAGGGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007985.2-765s21c1
Sequence:CCGGTACTATCCTAGTTTGCTTAAACTCGAGTTTAAGCAAACTAGGATAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-1664s21c1
Sequence:CCGGGGTGGAGCTGAAGGTATTAATCTCGAGATTAATACCTTCAGCTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-830s21c1
Sequence:CCGGTAATGGACTGAGCACTCAAAGCTCGAGCTTTGAGTGCTCAGTCCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-741s21c1
Sequence:CCGGAGTCTTGGATATGAGTCTATTCTCGAGAATAGACTCATATCCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007985.1-1237s1c1
Sequence:CCGGCCAGAAGTACTAGCTGCTCTTCTCGAGAAGAGCAGCTAGTACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007985.1-679s1c1
Sequence:CCGGGCATTCAGATTCGACATGAAACTCGAGTTTCATGTCGAATCTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007985.1-2241s1c1
Sequence:CCGGGCGGTCCATGAGTATTATGAACTCGAGTTCATAATACTCATGGACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007985
VALIDATED
FANCC MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-2500s21c1
Sequence:CCGGTGCTTCCCTATGTCTAGTAAACTCGAGTTTACTAGACATAGGGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007985.2-765s21c1
Sequence:CCGGTACTATCCTAGTTTGCTTAAACTCGAGTTTAAGCAAACTAGGATAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-1664s21c1
Sequence:CCGGGGTGGAGCTGAAGGTATTAATCTCGAGATTAATACCTTCAGCTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-830s21c1
Sequence:CCGGTAATGGACTGAGCACTCAAAGCTCGAGCTTTGAGTGCTCAGTCCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-741s21c1
Sequence:CCGGAGTCTTGGATATGAGTCTATTCTCGAGAATAGACTCATATCCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007985.1-1237s1c1
Sequence:CCGGCCAGAAGTACTAGCTGCTCTTCTCGAGAAGAGCAGCTAGTACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007985.1-679s1c1
Sequence:CCGGGCATTCAGATTCGACATGAAACTCGAGTTTCATGTCGAATCTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007985.1-2241s1c1
Sequence:CCGGGCGGTCCATGAGTATTATGAACTCGAGTTCATAATACTCATGGACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007985
VALIDATED
FANCC MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-2500s21c1
Sequence:CCGGTGCTTCCCTATGTCTAGTAAACTCGAGTTTACTAGACATAGGGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007985.2-765s21c1
Sequence:CCGGTACTATCCTAGTTTGCTTAAACTCGAGTTTAAGCAAACTAGGATAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-1664s21c1
Sequence:CCGGGGTGGAGCTGAAGGTATTAATCTCGAGATTAATACCTTCAGCTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-830s21c1
Sequence:CCGGTAATGGACTGAGCACTCAAAGCTCGAGCTTTGAGTGCTCAGTCCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007985.2-741s21c1
Sequence:CCGGAGTCTTGGATATGAGTCTATTCTCGAGAATAGACTCATATCCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007985.1-1237s1c1
Sequence:CCGGCCAGAAGTACTAGCTGCTCTTCTCGAGAAGAGCAGCTAGTACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007985.1-679s1c1
Sequence:CCGGGCATTCAGATTCGACATGAAACTCGAGTTTCATGTCGAATCTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007985.1-2241s1c1
Sequence:CCGGGCGGTCCATGAGTATTATGAACTCGAGTTCATAATACTCATGGACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)