EMAIL THIS PAGE TO A FRIEND

FANCD2

Fanconi anemia, complementation group D2

83 Gene Product Result for
Synonyms: FA-D2 FA4 FACD FAD FAD2 FANCD
UniProtKB ID: Q9BXW9, Q2LA86, Q69YP9, Q6PJN7, Q9BQ06, Q9H9T9
Gene ID:
Human(2177) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(211651) Fanconi anemia, complementation group D2
Rat(312641) Fanconi anemia, complementation group D2
Zebrafish(394241) Fanconi anemia, complementation group D2
cow(515845) Fanconi anemia, complementation group D2
Horse(100051871) Fanconi anemia, complementation group D2
domestic cat(101092341) Fanconi anemia, complementation group D2
fruit fly(2768674) CG17269 gene product from transcript CG17269-RA
chicken(415935) Fanconi anemia, complementation group D2
dog(484659) Fanconi anemia, complementation group D2
domestic guinea pig(100729511) Fanconi anemia, complementation group D2
naked mole-rat(101705946) Fanconi anemia, complementation group D2
sheep(101123503) Fanconi anemia, complementation group D2
Domestic Rabbit(100346581) Fanconi anemia, complementation group D2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033084 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018115 Rosetta Predictions human pricing
NM_033084 Rosetta Predictions human pricing
NM_001001719 Rosetta Predictions rat pricing
XM_579063 Rosetta Predictions rat pricing
NM_001033244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137854 predicted 2326
2 SASI_Hs02_00307032 predicted 466
3 SASI_Hs01_00137856 predicted 450
4 SASI_Hs02_00307033 predicted 3911
5 SASI_Hs01_00137857 predicted 1588
6 SASI_Hs02_00307034 predicted 3158
7 SASI_Hs01_00137858 predicted 1726
8 SASI_Hs01_00137859 predicted 3878
9 SASI_Hs01_00137861 predicted 1271
10 SASI_Hs01_00137862 predicted 2400
11 SASI_Hs01_00137855 predicted 1361
12 SASI_Hs01_00137860 predicted 1410
13 SASI_Hs01_00137863 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064790 predicted 2323
2 SASI_Hs02_00360786 predicted 471
3 SASI_Hs01_00064792 predicted 443
4 SASI_Hs02_00360787 predicted 3906
5 SASI_Hs01_00064793 predicted 1588
6 SASI_Hs02_00360788 predicted 3155
7 SASI_Hs01_00064794 predicted 1732
8 SASI_Hs01_00064795 predicted 3871
9 SASI_Hs01_00064797 predicted 1262
10 SASI_Hs01_00064798 predicted 2393
11 SASI_Hs01_00064791 predicted 1364
12 SASI_Hs01_00064796 predicted 1413
13 SASI_Hs01_00064799 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062906 predicted 836
2 SASI_Rn01_00062907 predicted 543
3 SASI_Rn01_00062908 predicted 1619
4 SASI_Rn01_00062909 predicted 1138
5 SASI_Rn02_00197935 predicted 2998
6 SASI_Rn02_00197936 predicted 587
7 SASI_Rn02_00197937 predicted 2337
8 SASI_Rn01_00062911 predicted 3858
9 SASI_Rn01_00062913 predicted 4007
10 SASI_Rn01_00062914 predicted 3235
11 SASI_Rn01_00062910 predicted 2549
12 SASI_Rn01_00062912 predicted 828
13 SASI_Rn01_00062915 predicted 2433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146136 predicted 840
2 SASI_Rn01_00146137 predicted 548
3 SASI_Rn01_00146138 predicted 1621
4 SASI_Rn01_00146139 predicted 1147
5 SASI_Rn01_00146140 predicted 2547
6 SASI_Rn01_00146141 predicted 3872
7 SASI_Rn01_00146142 predicted 826
8 SASI_Rn01_00146143 predicted 4020
9 SASI_Rn01_00146144 predicted 3234
10 SASI_Rn01_00146145 predicted 2433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288399 predicted 4262
2 SASI_Mm02_00288400 predicted 1197
3 SASI_Mm01_00167128 predicted 2588
4 SASI_Mm01_00167129 predicted 2628
5 SASI_Mm01_00167130 predicted 2408
6 SASI_Mm01_00167131 predicted 673
7 SASI_Mm01_00167132 predicted 1002
8 SASI_Mm01_00167134 predicted 3312
9 SASI_Mm01_00167135 predicted 1177
10 SASI_Mm01_00167136 predicted 1225
11 SASI_Mm01_00167133 predicted 3949
12 SASI_Mm01_00167137 predicted 1593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033084
FANCD2 MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group D2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-875s1c1
Sequence:CCGGCGTCTATTAGATTGGAGGATTCTCGAGAATCCTCCAATCTAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-3404s1c1
Sequence:CCGGGCGTCCATTACTTGCAGAATTCTCGAGAATTCTGCAAGTAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-2617s1c1
Sequence:CCGGCCTCATACTGTTACTGCTATTCTCGAGAATAGCAGTAACAGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-4337s1c1
Sequence:CCGGCCACTGAGGTATCTCTACAAACTCGAGTTTGTAGAGATACCTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-583s1c1
Sequence:CCGGCGACTCATTGTCAGTCAACTACTCGAGTAGTTGACTGACAATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033084.3-4838s21c1
Sequence:CCGGACAGATGCTTTCGACAATTTACTCGAGTAAATTGTCGAAAGCATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033084.3-664s21c1
Sequence:CCGGATCATGCAGCTGATCAGTATTCTCGAGAATACTGATCAGCTGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033084.3-4658s21c1
Sequence:CCGGGGGAGAAGTCATCGAAGTATTCTCGAGAATACTTCGATGACTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033084
FANCD2 MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group D2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-875s1c1
Sequence:CCGGCGTCTATTAGATTGGAGGATTCTCGAGAATCCTCCAATCTAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-3404s1c1
Sequence:CCGGGCGTCCATTACTTGCAGAATTCTCGAGAATTCTGCAAGTAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-2617s1c1
Sequence:CCGGCCTCATACTGTTACTGCTATTCTCGAGAATAGCAGTAACAGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-4337s1c1
Sequence:CCGGCCACTGAGGTATCTCTACAAACTCGAGTTTGTAGAGATACCTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-583s1c1
Sequence:CCGGCGACTCATTGTCAGTCAACTACTCGAGTAGTTGACTGACAATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033084.3-4838s21c1
Sequence:CCGGACAGATGCTTTCGACAATTTACTCGAGTAAATTGTCGAAAGCATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033084.3-664s21c1
Sequence:CCGGATCATGCAGCTGATCAGTATTCTCGAGAATACTGATCAGCTGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033084.3-4658s21c1
Sequence:CCGGGGGAGAAGTCATCGAAGTATTCTCGAGAATACTTCGATGACTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033084
FANCD2 MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group D2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-875s1c1
Sequence:CCGGCGTCTATTAGATTGGAGGATTCTCGAGAATCCTCCAATCTAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-3404s1c1
Sequence:CCGGGCGTCCATTACTTGCAGAATTCTCGAGAATTCTGCAAGTAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-2617s1c1
Sequence:CCGGCCTCATACTGTTACTGCTATTCTCGAGAATAGCAGTAACAGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-4337s1c1
Sequence:CCGGCCACTGAGGTATCTCTACAAACTCGAGTTTGTAGAGATACCTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033084.2-583s1c1
Sequence:CCGGCGACTCATTGTCAGTCAACTACTCGAGTAGTTGACTGACAATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033084.3-4838s21c1
Sequence:CCGGACAGATGCTTTCGACAATTTACTCGAGTAAATTGTCGAAAGCATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033084.3-664s21c1
Sequence:CCGGATCATGCAGCTGATCAGTATTCTCGAGAATACTGATCAGCTGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033084.3-4658s21c1
Sequence:CCGGGGGAGAAGTCATCGAAGTATTCTCGAGAATACTTCGATGACTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033244
VALIDATED
FANCD2 MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group D2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033244.2-1633s21c1
Sequence:CCGGTTAAGGGCATCTTAGATTATTCTCGAGAATAATCTAAGATGCCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-3896s21c1
Sequence:CCGGGAACATGGCTGTCCGAGATTTCTCGAGAAATCTCGGACAGCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-4587s21c1
Sequence:CCGGGGGTTTCACAGGTTGTCTAACCTCGAGGTTAGACAACCTGTGAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-3368s21c1
Sequence:CCGGGGTCCTCTCGAACCGACTAAACTCGAGTTTAGTCGGTTCGAGAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-2439s21c1
Sequence:CCGGTCGCTCACATTCCTAACTTTCCTCGAGGAAAGTTAGGAATGTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033244
VALIDATED
FANCD2 MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group D2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033244.2-1633s21c1
Sequence:CCGGTTAAGGGCATCTTAGATTATTCTCGAGAATAATCTAAGATGCCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-3896s21c1
Sequence:CCGGGAACATGGCTGTCCGAGATTTCTCGAGAAATCTCGGACAGCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-4587s21c1
Sequence:CCGGGGGTTTCACAGGTTGTCTAACCTCGAGGTTAGACAACCTGTGAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-3368s21c1
Sequence:CCGGGGTCCTCTCGAACCGACTAAACTCGAGTTTAGTCGGTTCGAGAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-2439s21c1
Sequence:CCGGTCGCTCACATTCCTAACTTTCCTCGAGGAAAGTTAGGAATGTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033244
VALIDATED
FANCD2 MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group D2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033244.2-1633s21c1
Sequence:CCGGTTAAGGGCATCTTAGATTATTCTCGAGAATAATCTAAGATGCCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-3896s21c1
Sequence:CCGGGAACATGGCTGTCCGAGATTTCTCGAGAAATCTCGGACAGCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-4587s21c1
Sequence:CCGGGGGTTTCACAGGTTGTCTAACCTCGAGGTTAGACAACCTGTGAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-3368s21c1
Sequence:CCGGGGTCCTCTCGAACCGACTAAACTCGAGTTTAGTCGGTTCGAGAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033244.2-2439s21c1
Sequence:CCGGTCGCTCACATTCCTAACTTTCCTCGAGGAAAGTTAGGAATGTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks