EMAIL THIS PAGE TO A FRIEND

FANCD2OS

FANCD2 opposite strand

71 Gene Product Result for
Synonyms: C3orf24
UniProtKB ID: Q96PS1
Gene ID:
Human(115795) Summary: This gene encodes a conserved protein of unknown function. [provided by RefSeq, Jan 2013]
Mouse(70979) Fancd2 opposite strand
Rat(500294) FANCD2 opposite strand
sheep(101123076) FANCD2 opposite strand
naked mole-rat(101706519) FANCD2 opposite strand
domestic guinea pig(100717800) FANCD2 opposite strand
cow(768064) FANCD2 opposite strand
dog(100683100) FANCD2 opposite strand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105893 Anti-C3ORF24 antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173472 Rosetta Predictions human pricing
NM_001109251 Rosetta Predictions rat pricing
NM_027633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138954 predicted 690
2 SASI_Hs01_00138955 predicted 455
3 SASI_Hs01_00138956 predicted 518
4 SASI_Hs01_00138957 predicted 436
5 SASI_Hs01_00138958 predicted 446
6 SASI_Hs02_00368226 predicted 426
7 SASI_Hs01_00138960 predicted 748
8 SASI_Hs02_00368227 predicted 698
9 SASI_Hs01_00138961 predicted 267
10 SASI_Hs01_00138963 predicted 373
11 SASI_Hs01_00138959 predicted 530
12 SASI_Hs01_00138962 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246574 predicted 747
2 SASI_Rn02_00246575 predicted 556
3 SASI_Rn02_00246576 predicted 767
4 SASI_Rn02_00246577 predicted 496
5 SASI_Rn02_00246578 predicted 767
6 SASI_Rn02_00246579 predicted 761
7 SASI_Rn02_00246580 predicted 737
8 SASI_Rn02_00246581 predicted 263
9 SASI_Rn02_00246582 predicted 474
10 SASI_Rn02_00246583 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332501 predicted 569
2 SASI_Mm01_00201547 predicted 420
3 SASI_Mm01_00201548 predicted 598
4 SASI_Mm01_00201549 predicted 346
5 SASI_Mm01_00201550 predicted 502
6 SASI_Mm01_00201551 predicted 751
7 SASI_Mm02_00332502 predicted 761
8 SASI_Mm01_00201552 predicted 592
9 SASI_Mm01_00201554 predicted 577
10 SASI_Mm01_00201555 predicted 474
11 SASI_Mm01_00201553 predicted 622
12 SASI_Mm01_00201556 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027633
FANCD2OS MISSION shRNA Bacterial Glycerol Stock
FANCD2 opposite strand
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-343s21c1
Sequence:CCGGCCAAGTTACCCTGCCACAAATCTCGAGATTTGTGGCAGGGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-615s21c1
Sequence:CCGGCTCTTGCTGTATGCGACTTACCTCGAGGTAAGTCGCATACAGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027633.2-833s21c1
Sequence:CCGGCTAGTTGAGCACACCTTAAATCTCGAGATTTAAGGTGTGCTCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-652s21c1
Sequence:CCGGCCTTGCAGCACTCCAAGTAAACTCGAGTTTACTTGGAGTGCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027633
FANCD2OS MISSION shRNA shRNA Plasmid DNA
FANCD2 opposite strand
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-343s21c1
Sequence:CCGGCCAAGTTACCCTGCCACAAATCTCGAGATTTGTGGCAGGGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-615s21c1
Sequence:CCGGCTCTTGCTGTATGCGACTTACCTCGAGGTAAGTCGCATACAGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027633.2-833s21c1
Sequence:CCGGCTAGTTGAGCACACCTTAAATCTCGAGATTTAAGGTGTGCTCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-652s21c1
Sequence:CCGGCCTTGCAGCACTCCAAGTAAACTCGAGTTTACTTGGAGTGCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027633
FANCD2OS MISSION shRNA Lentiviral Transduction Particles
FANCD2 opposite strand
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-343s21c1
Sequence:CCGGCCAAGTTACCCTGCCACAAATCTCGAGATTTGTGGCAGGGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-615s21c1
Sequence:CCGGCTCTTGCTGTATGCGACTTACCTCGAGGTAAGTCGCATACAGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027633.2-833s21c1
Sequence:CCGGCTAGTTGAGCACACCTTAAATCTCGAGATTTAAGGTGTGCTCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027633.2-652s21c1
Sequence:CCGGCCTTGCAGCACTCCAAGTAAACTCGAGTTTACTTGGAGTGCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173472
FANCD2OS MISSION shRNA Bacterial Glycerol Stock
FANCD2 opposite strand
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-259s1c1
Sequence:CCGGCCACTGGATGAGAGTTTCCAACTCGAGTTGGAAACTCTCATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173472.1-911s1c1
Sequence:CCGGGCAGGAAGACATTATGTGGTACTCGAGTACCACATAATGTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-657s1c1
Sequence:CCGGGATTCAGATGACAGTCACTATCTCGAGATAGTGACTGTCATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-702s1c1
Sequence:CCGGCCTCTTGCTGTATGCAACTTACTCGAGTAAGTTGCATACAGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-663s1c1
Sequence:CCGGGATGACAGTCACTATGTGCAACTCGAGTTGCACATAGTGACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-570s1c1
Sequence:CCGGCGGGACTTTCAGAGTTTCAGACTCGAGTCTGAAACTCTGAAAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-468s1c1
Sequence:CCGGGATGAACAACAAAGGACTGGTCTCGAGACCAGTCCTTTGTTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-583s1c1
Sequence:CCGGGTTTCAGACAAGTCAGCCTTTCTCGAGAAAGGCTGACTTGTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-364s1c1
Sequence:CCGGGAAGTGCAGCTGTGCTTTCAACTCGAGTTGAAAGCACAGCTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-681s1c1
Sequence:CCGGCAAACAGATGCTGCGCTCTATCTCGAGATAGAGCGCAGCATCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-573s1c1
Sequence:CCGGGACTTTCAGAGTTTCAGACAACTCGAGTTGTCTGAAACTCTGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173472
FANCD2OS MISSION shRNA shRNA Plasmid DNA
FANCD2 opposite strand
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-259s1c1
Sequence:CCGGCCACTGGATGAGAGTTTCCAACTCGAGTTGGAAACTCTCATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173472.1-911s1c1
Sequence:CCGGGCAGGAAGACATTATGTGGTACTCGAGTACCACATAATGTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-657s1c1
Sequence:CCGGGATTCAGATGACAGTCACTATCTCGAGATAGTGACTGTCATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-702s1c1
Sequence:CCGGCCTCTTGCTGTATGCAACTTACTCGAGTAAGTTGCATACAGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-663s1c1
Sequence:CCGGGATGACAGTCACTATGTGCAACTCGAGTTGCACATAGTGACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-570s1c1
Sequence:CCGGCGGGACTTTCAGAGTTTCAGACTCGAGTCTGAAACTCTGAAAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-468s1c1
Sequence:CCGGGATGAACAACAAAGGACTGGTCTCGAGACCAGTCCTTTGTTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-583s1c1
Sequence:CCGGGTTTCAGACAAGTCAGCCTTTCTCGAGAAAGGCTGACTTGTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-364s1c1
Sequence:CCGGGAAGTGCAGCTGTGCTTTCAACTCGAGTTGAAAGCACAGCTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-681s1c1
Sequence:CCGGCAAACAGATGCTGCGCTCTATCTCGAGATAGAGCGCAGCATCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-573s1c1
Sequence:CCGGGACTTTCAGAGTTTCAGACAACTCGAGTTGTCTGAAACTCTGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173472
FANCD2OS MISSION shRNA Lentiviral Transduction Particles
FANCD2 opposite strand
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-259s1c1
Sequence:CCGGCCACTGGATGAGAGTTTCCAACTCGAGTTGGAAACTCTCATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173472.1-911s1c1
Sequence:CCGGGCAGGAAGACATTATGTGGTACTCGAGTACCACATAATGTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-657s1c1
Sequence:CCGGGATTCAGATGACAGTCACTATCTCGAGATAGTGACTGTCATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-702s1c1
Sequence:CCGGCCTCTTGCTGTATGCAACTTACTCGAGTAAGTTGCATACAGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-663s1c1
Sequence:CCGGGATGACAGTCACTATGTGCAACTCGAGTTGCACATAGTGACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-570s1c1
Sequence:CCGGCGGGACTTTCAGAGTTTCAGACTCGAGTCTGAAACTCTGAAAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-468s1c1
Sequence:CCGGGATGAACAACAAAGGACTGGTCTCGAGACCAGTCCTTTGTTGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-583s1c1
Sequence:CCGGGTTTCAGACAAGTCAGCCTTTCTCGAGAAAGGCTGACTTGTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-364s1c1
Sequence:CCGGGAAGTGCAGCTGTGCTTTCAACTCGAGTTGAAAGCACAGCTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173472.1-681s1c1
Sequence:CCGGCAAACAGATGCTGCGCTCTATCTCGAGATAGAGCGCAGCATCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173472.1-573s1c1
Sequence:CCGGGACTTTCAGAGTTTCAGACAACTCGAGTTGTCTGAAACTCTGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks