EMAIL THIS PAGE TO A FRIEND

FANCE

Fanconi anemia, complementation group E

78 Gene Product Result for
Synonyms: FACE FAE
UniProtKB ID: Q9HB96, A8K907, Q4ZGH2
Gene ID:
Human(2178) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group E. [provided by RefSeq, Jul 2008]
Mouse(72775) Fanconi anemia, complementation group E
Rat(309643) Fanconi anemia, complementation group E
Zebrafish(565685) Fanconi anemia, complementation group E
cow(513464) Fanconi anemia, complementation group E
domestic cat(101089771) Fanconi anemia, complementation group E
dog(608172) Fanconi anemia, complementation group E
chicken(419891) Fanconi anemia, complementation group E
domestic guinea pig(100731486) Fanconi anemia, complementation group E
naked mole-rat(101721106) Fanconi anemia, complementation group E
sheep(101121980) Fanconi anemia, complementation group E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021922 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049561 MISSION® esiRNA esiRNA human FANCE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021922 Rosetta Predictions human pricing
XM_001078335 Rosetta Predictions rat pricing
XM_228032 Rosetta Predictions rat pricing
XM_001472126 Rosetta Predictions mouse pricing
XM_915490 Rosetta Predictions mouse pricing
XM_986338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355198 predicted 1467
2 SASI_Hs01_00028355 predicted 417
3 SASI_Hs01_00028356 predicted 1676
4 SASI_Hs01_00028357 predicted 1481
5 SASI_Hs01_00028358 predicted 1753
6 SASI_Hs01_00028360 predicted 593
7 SASI_Hs01_00028361 predicted 912
8 SASI_Hs01_00028362 predicted 979
9 SASI_Hs01_00028363 predicted 871
10 SASI_Hs01_00028364 predicted 1652
11 SASI_Hs01_00028359 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360428 predicted 958
2 SASI_Rn02_00360429 predicted 1220
3 SASI_Rn02_00360430 predicted 371
4 SASI_Rn02_00360431 predicted 1540
5 SASI_Rn02_00360432 predicted 1232
6 SASI_Rn02_00360433 predicted 1369
7 SASI_Rn02_00360434 predicted 609
8 SASI_Rn02_00360435 predicted 221
9 SASI_Rn02_00360436 predicted 1461
10 SASI_Rn02_00360437 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384851 predicted 959
2 SASI_Rn02_00384852 predicted 1220
3 SASI_Rn02_00384853 predicted 369
4 SASI_Rn02_00384854 predicted 1538
5 SASI_Rn02_00384855 predicted 1232
6 SASI_Rn02_00384856 predicted 1371
7 SASI_Rn02_00384857 predicted 607
8 SASI_Rn02_00384858 predicted 1459
9 SASI_Rn02_00384859 predicted 1398
10 SASI_Rn02_00384860 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00359422 predicted 905
2 SASI_Mm02_00359423 predicted 460
3 SASI_Mm02_00359424 predicted 1651
4 SASI_Mm02_00359425 predicted 1004
5 SASI_Mm02_00359426 predicted 1561
6 SASI_Mm02_00359427 predicted 1229
7 SASI_Mm02_00359428 predicted 666
8 SASI_Mm02_00359429 predicted 1465
9 SASI_Mm02_00359430 predicted 1042
10 SASI_Mm02_00359431 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439498 predicted 896
2 SASI_Mm02_00439499 predicted 456
3 SASI_Mm02_00439500 predicted 1652
4 SASI_Mm02_00439501 predicted 1009
5 SASI_Mm02_00439502 predicted 1557
6 SASI_Mm02_00439503 predicted 1225
7 SASI_Mm02_00439504 predicted 663
8 SASI_Mm02_00439505 predicted 1467
9 SASI_Mm02_00439506 predicted 1040
10 SASI_Mm02_00439507 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254863 predicted 900
2 SASI_Mm01_00254864 predicted 463
3 SASI_Mm01_00254865 predicted 1006
4 SASI_Mm01_00254866 predicted 1231
5 SASI_Mm01_00254867 predicted 666
6 SASI_Mm01_00254868 predicted 1040
7 SASI_Mm01_00254869 predicted 826
8 SASI_Mm01_00254870 predicted 557
9 SASI_Mm01_00254871 predicted 915
10 SASI_Mm01_00254872 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021922
VALIDATED
FANCE MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group E
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-640s1c1
Sequence:CCGGGAGCTTCTCCACTGTCTGAAACTCGAGTTTCAGACAGTGGAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1125s1c1
Sequence:CCGGCAGCTTCTTCACGAATGTAGTCTCGAGACTACATTCGTGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-885s1c2
Sequence:CCGGCCCGAACATAAGTCACTGGAACTCGAGTTCCAGTGACTTATGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1589s1c1
Sequence:CCGGGTTCAGTGTCTTAATGGAGAACTCGAGTTCTCCATTAAGACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1360s1c1
Sequence:CCGGCCAAATATACATACCCTGTCTCTCGAGAGACAGGGTATGTATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1581s1c1
Sequence:CCGGCCTGAGAAGTTCAGTGTCTTACTCGAGTAAGACACTGAACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021922.1-461s1c1
Sequence:CCGGGATATGCCAGAGGAACCTGATCTCGAGATCAGGTTCCTCTGGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-885s1c1
Sequence:CCGGCCCGAACATAAGTCACTGGAACTCGAGTTCCAGTGACTTATGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1348s1c1
Sequence:CCGGCCTCCTTCTGTGCCAAATATACTCGAGTATATTTGGCACAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1673s1c1
Sequence:CCGGGATGACCAAGTATCAGGCTAACTCGAGTTAGCCTGATACTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021922
VALIDATED
FANCE MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group E
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-640s1c1
Sequence:CCGGGAGCTTCTCCACTGTCTGAAACTCGAGTTTCAGACAGTGGAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1125s1c1
Sequence:CCGGCAGCTTCTTCACGAATGTAGTCTCGAGACTACATTCGTGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-885s1c2
Sequence:CCGGCCCGAACATAAGTCACTGGAACTCGAGTTCCAGTGACTTATGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1589s1c1
Sequence:CCGGGTTCAGTGTCTTAATGGAGAACTCGAGTTCTCCATTAAGACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1360s1c1
Sequence:CCGGCCAAATATACATACCCTGTCTCTCGAGAGACAGGGTATGTATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1581s1c1
Sequence:CCGGCCTGAGAAGTTCAGTGTCTTACTCGAGTAAGACACTGAACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021922.1-461s1c1
Sequence:CCGGGATATGCCAGAGGAACCTGATCTCGAGATCAGGTTCCTCTGGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-885s1c1
Sequence:CCGGCCCGAACATAAGTCACTGGAACTCGAGTTCCAGTGACTTATGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1348s1c1
Sequence:CCGGCCTCCTTCTGTGCCAAATATACTCGAGTATATTTGGCACAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1673s1c1
Sequence:CCGGGATGACCAAGTATCAGGCTAACTCGAGTTAGCCTGATACTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021922
VALIDATED
FANCE MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group E
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-640s1c1
Sequence:CCGGGAGCTTCTCCACTGTCTGAAACTCGAGTTTCAGACAGTGGAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1125s1c1
Sequence:CCGGCAGCTTCTTCACGAATGTAGTCTCGAGACTACATTCGTGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-885s1c2
Sequence:CCGGCCCGAACATAAGTCACTGGAACTCGAGTTCCAGTGACTTATGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1589s1c1
Sequence:CCGGGTTCAGTGTCTTAATGGAGAACTCGAGTTCTCCATTAAGACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1360s1c1
Sequence:CCGGCCAAATATACATACCCTGTCTCTCGAGAGACAGGGTATGTATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1581s1c1
Sequence:CCGGCCTGAGAAGTTCAGTGTCTTACTCGAGTAAGACACTGAACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021922.1-461s1c1
Sequence:CCGGGATATGCCAGAGGAACCTGATCTCGAGATCAGGTTCCTCTGGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-885s1c1
Sequence:CCGGCCCGAACATAAGTCACTGGAACTCGAGTTCCAGTGACTTATGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1348s1c1
Sequence:CCGGCCTCCTTCTGTGCCAAATATACTCGAGTATATTTGGCACAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021922.1-1673s1c1
Sequence:CCGGGATGACCAAGTATCAGGCTAACTCGAGTTAGCCTGATACTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163820
FANCE MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group E
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1047s21c1
Sequence:CCGGCAGCGAGATGGAGTTGCTATGCTCGAGCATAGCAACTCCATCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1020s21c1
Sequence:CCGGCCTGCAGTTTCTTCATGAATGCTCGAGCATTCATGAAGAAACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1376s21c1
Sequence:CCGGCAGACATGCAGGTCCAGATTTCTCGAGAAATCTGGACCTGCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1338s21c1
Sequence:CCGGGTTACTGTGTTCCCTCATAAACTCGAGTTTATGAGGGAACACAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-686s21c1
Sequence:CCGGTTTGCGGGAAACGGACGAAAGCTCGAGCTTTCGTCCGTTTCCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163820.1-1707s21c1
Sequence:CCGGTACCACTCCTGACAACATCAGCTCGAGCTGATGTTGTCAGGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1557s21c1
Sequence:CCGGTGTGACCCACTGACCATACACCTCGAGGTGTATGGTCAGTGGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163820
FANCE MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group E
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1047s21c1
Sequence:CCGGCAGCGAGATGGAGTTGCTATGCTCGAGCATAGCAACTCCATCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1020s21c1
Sequence:CCGGCCTGCAGTTTCTTCATGAATGCTCGAGCATTCATGAAGAAACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1376s21c1
Sequence:CCGGCAGACATGCAGGTCCAGATTTCTCGAGAAATCTGGACCTGCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1338s21c1
Sequence:CCGGGTTACTGTGTTCCCTCATAAACTCGAGTTTATGAGGGAACACAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-686s21c1
Sequence:CCGGTTTGCGGGAAACGGACGAAAGCTCGAGCTTTCGTCCGTTTCCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163820.1-1707s21c1
Sequence:CCGGTACCACTCCTGACAACATCAGCTCGAGCTGATGTTGTCAGGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1557s21c1
Sequence:CCGGTGTGACCCACTGACCATACACCTCGAGGTGTATGGTCAGTGGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163820
FANCE MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group E
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1047s21c1
Sequence:CCGGCAGCGAGATGGAGTTGCTATGCTCGAGCATAGCAACTCCATCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1020s21c1
Sequence:CCGGCCTGCAGTTTCTTCATGAATGCTCGAGCATTCATGAAGAAACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1376s21c1
Sequence:CCGGCAGACATGCAGGTCCAGATTTCTCGAGAAATCTGGACCTGCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1338s21c1
Sequence:CCGGGTTACTGTGTTCCCTCATAAACTCGAGTTTATGAGGGAACACAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-686s21c1
Sequence:CCGGTTTGCGGGAAACGGACGAAAGCTCGAGCTTTCGTCCGTTTCCCGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163820.1-1707s21c1
Sequence:CCGGTACCACTCCTGACAACATCAGCTCGAGCTGATGTTGTCAGGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163820.1-1557s21c1
Sequence:CCGGTGTGACCCACTGACCATACACCTCGAGGTGTATGGTCAGTGGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks