EMAIL THIS PAGE TO A FRIEND

FANCF

Fanconi anemia, complementation group F

67 Gene Product Result for
Synonyms: FAF
UniProtKB ID: Q9NPI8, Q52LM0
Gene ID:
Human(2188) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008]
Mouse(100040608) Fanconi anemia, complementation group F
Rat(499155) Fanconi anemia, complementation group F
sheep(101119858) Fanconi anemia, complementation group F
naked mole-rat(101714180) Fanconi anemia, complementation group F
domestic guinea pig(100728032) Fanconi anemia, complementation group F
Zebrafish(692250) Fanconi anemia, complementation group F
chicken(101750641) Fanconi anemia, complementation group F
domestic cat(101099076) Fanconi anemia, complementation group F
cow(539681) Fanconi anemia, complementation group F
chicken(101667608) Fanconi anemia, complementation group F
chicken(770997) Fanconi anemia, complementation group F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001115087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001115087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001115087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006001 MISSION® esiRNA esiRNA targeting human FANCF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022725 Rosetta Predictions human pricing
XM_001080926 Rosetta Predictions rat pricing
XM_574453 Rosetta Predictions rat pricing
NM_001115087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140429 predicted 1306
2 SASI_Hs01_00140430 predicted 841
3 SASI_Hs02_00355945 predicted 1071
4 SASI_Hs02_00355946 predicted 1348
5 SASI_Hs01_00140427 predicted 1359
6 SASI_Hs01_00140436 predicted 344
7 SASI_Hs02_00355947 predicted 1159
8 SASI_Hs02_00355948 predicted 477
9 SASI_Hs02_00355949 predicted 465
10 SASI_Hs02_00355950 predicted 881
11 SASI_Hs01_00140428 predicted 1001
12 SASI_Hs01_00140431 predicted 1289
13 SASI_Hs01_00140432 predicted 1349
14 SASI_Hs01_00140433 predicted 1415
15 SASI_Hs01_00140434 predicted 1320
16 SASI_Hs01_00140435 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369860 predicted 1306
2 SASI_Rn02_00369861 predicted 1240
3 SASI_Rn02_00369862 predicted 1064
4 SASI_Rn02_00369863 predicted 1196
5 SASI_Rn02_00369864 predicted 1411
6 SASI_Rn02_00369865 predicted 1090
7 SASI_Rn02_00369866 predicted 1382
8 SASI_Rn02_00369867 predicted 1061
9 SASI_Rn02_00369868 predicted 1384
10 SASI_Rn02_00369869 predicted 1429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402041 predicted 1309
2 SASI_Rn02_00402042 predicted 1234
3 SASI_Rn02_00402043 predicted 1065
4 SASI_Rn02_00402044 predicted 1199
5 SASI_Rn02_00402045 predicted 1407
6 SASI_Rn02_00402046 predicted 1094
7 SASI_Rn02_00402047 predicted 1377
8 SASI_Rn02_00402048 predicted 1062
9 SASI_Rn02_00402049 predicted 1378
10 SASI_Rn02_00402050 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308947 predicted 648
2 SASI_Mm02_00308948 predicted 873
3 SASI_Mm02_00308949 predicted 948
4 SASI_Mm02_00308950 predicted 890
5 SASI_Mm02_00308951 predicted 858
6 SASI_Mm02_00308952 predicted 1012
7 SASI_Mm02_00308953 predicted 657
8 SASI_Mm02_00308954 predicted 982
9 SASI_Mm02_00308955 predicted 890
10 SASI_Mm02_00308956 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022725
VALIDATED
FANCF MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group F
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022725.3-1610s21c1
Sequence:CCGGTGGCCTTGTTAACCTAGTATTCTCGAGAATACTAGGTTAACAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022725.3-1153s21c1
Sequence:CCGGATAGGCAATGCTGTGTTATTACTCGAGTAATAACACAGCATTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022725.3-619s21c1
Sequence:CCGGGCCTCAGAACAACTTCCTGAACTCGAGTTCAGGAAGTTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022725.3-1088s21c1
Sequence:CCGGGCTCTTCGTAGTGGTGCATTTCTCGAGAAATGCACCACTACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022725.3-696s21c1
Sequence:CCGGTGGAACCCGGCATCCACAAATCTCGAGATTTGTGGATGCCGGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022725.2-2723s1c1
Sequence:CCGGGCCATCTTGTAGATTACATTTCTCGAGAAATGTAATCTACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-619s1c1
Sequence:CCGGGCCTCAGAACAACTTCCTGAACTCGAGTTCAGGAAGTTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022725.2-983s1c1
Sequence:CCGGCCTCCACCTCTGAAAGATAAACTCGAGTTTATCTTTCAGAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-1088s1c1
Sequence:CCGGGCTCTTCGTAGTGGTGCATTTCTCGAGAAATGCACCACTACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-986s1c1
Sequence:CCGGCCACCTCTGAAAGATAAAGTTCTCGAGAACTTTATCTTTCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022725
VALIDATED
FANCF MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group F
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022725.3-1610s21c1
Sequence:CCGGTGGCCTTGTTAACCTAGTATTCTCGAGAATACTAGGTTAACAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022725.3-1153s21c1
Sequence:CCGGATAGGCAATGCTGTGTTATTACTCGAGTAATAACACAGCATTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022725.3-619s21c1
Sequence:CCGGGCCTCAGAACAACTTCCTGAACTCGAGTTCAGGAAGTTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022725.3-1088s21c1
Sequence:CCGGGCTCTTCGTAGTGGTGCATTTCTCGAGAAATGCACCACTACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022725.3-696s21c1
Sequence:CCGGTGGAACCCGGCATCCACAAATCTCGAGATTTGTGGATGCCGGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022725.2-2723s1c1
Sequence:CCGGGCCATCTTGTAGATTACATTTCTCGAGAAATGTAATCTACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-619s1c1
Sequence:CCGGGCCTCAGAACAACTTCCTGAACTCGAGTTCAGGAAGTTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022725.2-983s1c1
Sequence:CCGGCCTCCACCTCTGAAAGATAAACTCGAGTTTATCTTTCAGAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-1088s1c1
Sequence:CCGGGCTCTTCGTAGTGGTGCATTTCTCGAGAAATGCACCACTACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-986s1c1
Sequence:CCGGCCACCTCTGAAAGATAAAGTTCTCGAGAACTTTATCTTTCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022725
VALIDATED
FANCF MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group F
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022725.3-1610s21c1
Sequence:CCGGTGGCCTTGTTAACCTAGTATTCTCGAGAATACTAGGTTAACAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022725.3-1153s21c1
Sequence:CCGGATAGGCAATGCTGTGTTATTACTCGAGTAATAACACAGCATTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022725.3-619s21c1
Sequence:CCGGGCCTCAGAACAACTTCCTGAACTCGAGTTCAGGAAGTTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022725.3-1088s21c1
Sequence:CCGGGCTCTTCGTAGTGGTGCATTTCTCGAGAAATGCACCACTACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022725.3-696s21c1
Sequence:CCGGTGGAACCCGGCATCCACAAATCTCGAGATTTGTGGATGCCGGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022725.2-2723s1c1
Sequence:CCGGGCCATCTTGTAGATTACATTTCTCGAGAAATGTAATCTACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-619s1c1
Sequence:CCGGGCCTCAGAACAACTTCCTGAACTCGAGTTCAGGAAGTTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022725.2-983s1c1
Sequence:CCGGCCTCCACCTCTGAAAGATAAACTCGAGTTTATCTTTCAGAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-1088s1c1
Sequence:CCGGGCTCTTCGTAGTGGTGCATTTCTCGAGAAATGCACCACTACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022725.2-986s1c1
Sequence:CCGGCCACCTCTGAAAGATAAAGTTCTCGAGAACTTTATCTTTCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001115087
FANCF MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group F
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-1029s21c1
Sequence:CCGGGGATCGTGCTAGAGTAGATTCCTCGAGGAATCTACTCTAGCACGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-127s21c1
Sequence:CCGGGCGTTATCTGCTCCACGTGTACTCGAGTACACGTGGAGCAGATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-528s21c1
Sequence:CCGGGCAAACTCCTGGACACGTTGTCTCGAGACAACGTGTCCAGGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001115087.1-1415s21c1
Sequence:CCGGTTTCAGCTTGTTTCGTATAAACTCGAGTTTATACGAAACAAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-682s21c1
Sequence:CCGGTCTCGAAAGTCCCGAGGTATTCTCGAGAATACCTCGGGACTTTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001115087
FANCF MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group F
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-1029s21c1
Sequence:CCGGGGATCGTGCTAGAGTAGATTCCTCGAGGAATCTACTCTAGCACGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-127s21c1
Sequence:CCGGGCGTTATCTGCTCCACGTGTACTCGAGTACACGTGGAGCAGATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-528s21c1
Sequence:CCGGGCAAACTCCTGGACACGTTGTCTCGAGACAACGTGTCCAGGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001115087.1-1415s21c1
Sequence:CCGGTTTCAGCTTGTTTCGTATAAACTCGAGTTTATACGAAACAAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-682s21c1
Sequence:CCGGTCTCGAAAGTCCCGAGGTATTCTCGAGAATACCTCGGGACTTTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001115087
FANCF MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group F
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-1029s21c1
Sequence:CCGGGGATCGTGCTAGAGTAGATTCCTCGAGGAATCTACTCTAGCACGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-127s21c1
Sequence:CCGGGCGTTATCTGCTCCACGTGTACTCGAGTACACGTGGAGCAGATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-528s21c1
Sequence:CCGGGCAAACTCCTGGACACGTTGTCTCGAGACAACGTGTCCAGGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001115087.1-1415s21c1
Sequence:CCGGTTTCAGCTTGTTTCGTATAAACTCGAGTTTATACGAAACAAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115087.1-682s21c1
Sequence:CCGGTCTCGAAAGTCCCGAGGTATTCTCGAGAATACCTCGGGACTTTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks