EMAIL THIS PAGE TO A FRIEND

FANCG

Fanconi anemia, complementation group G

58 Gene Product Result for
Synonyms: FAG XRCC9
UniProtKB ID: O15287
Gene ID:
Human(2189) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group G. [provided by RefSeq, Jul 2008]
Mouse(60534) Fanconi anemia, complementation group G
Rat(691105) Fanconi anemia, complementation group G
Zebrafish(402936) Fanconi anemia, complementation group G
domestic cat(101091661) Fanconi anemia, complementation group G
cow(615352) Fanconi anemia, complementation group G
Horse(100068211) Fanconi anemia, complementation group G
dog(611887) Fanconi anemia, complementation group G
chicken(378893) Fanconi anemia, complementation group G
domestic guinea pig(100726393) Fanconi anemia, complementation group G
naked mole-rat(101712516) Fanconi anemia, complementation group G
sheep(101118925) Fanconi anemia, complementation group G
Domestic Rabbit(100346331) Fanconi anemia, complementation group G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004629 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004629 Rosetta Predictions human pricing
XM_001076851 Rosetta Predictions rat pricing
NM_053081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225965 predicted 1005
2 SASI_Hs01_00225966 predicted 1718
3 SASI_Hs01_00225967 predicted 1874
4 SASI_Hs01_00225968 predicted 2137
5 SASI_Hs01_00225970 predicted 1215
6 SASI_Hs02_00338028 predicted 1527
7 SASI_Hs01_00225971 predicted 1804
8 SASI_Hs01_00225972 predicted 1658
9 SASI_Hs01_00225973 predicted 543
10 SASI_Hs01_00225974 predicted 1169
11 SASI_Hs01_00225969 predicted 2341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354783 predicted 1667
2 SASI_Rn02_00354784 predicted 1790
3 SASI_Rn02_00354785 predicted 1728
4 SASI_Rn02_00354786 predicted 207
5 SASI_Rn02_00354787 predicted 1791
6 SASI_Rn02_00354788 predicted 1775
7 SASI_Rn02_00354789 predicted 1573
8 SASI_Rn02_00354790 predicted 1734
9 SASI_Rn02_00354791 predicted 1730
10 SASI_Rn02_00354792 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149317 predicted 372
2 SASI_Mm01_00149318 predicted 1645
3 SASI_Mm01_00149319 predicted 622
4 SASI_Mm01_00149320 predicted 1435
5 SASI_Mm01_00149322 predicted 1657
6 SASI_Mm01_00149323 predicted 885
7 SASI_Mm01_00149324 predicted 1254
8 SASI_Mm01_00149325 predicted 981
9 SASI_Mm01_00149326 predicted 1599
10 SASI_Mm02_00337569 predicted 1107
11 SASI_Mm01_00149321 predicted 1194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004629
VALIDATED
FANCG MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group G
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-2494s1c1
Sequence:CCGGCCTGTGAAATTTGCCCTAGTTCTCGAGAACTAGGGCAAATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-2340s1c1
Sequence:CCGGGCCAAAGTCTTGTGACCTGTACTCGAGTACAGGTCACAAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-1009s1c1
Sequence:CCGGGCCTCTAAGGATCTGCTGTTACTCGAGTAACAGCAGATCCTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-1056s1c1
Sequence:CCGGTGAGGAATTAGATGCTCCATTCTCGAGAATGGAGCATCTAATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004629.1-1418s1c1
Sequence:CCGGCCTTGAATGTCCCATGCAGTTCTCGAGAACTGCATGGGACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-1395s21c1
Sequence:CCGGGAGTCTGGAGCTGCTAGTTGACTCGAGTCAACTAGCAGCTCCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-2159s21c1
Sequence:CCGGAGACTCTGAAGAGGCTAGATCCTCGAGGATCTAGCCTCTTCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-1295s21c1
Sequence:CCGGACTTGGTTGCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGCAACCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004629.1-2427s21c1
Sequence:CCGGTGCTTCACCATCATTAGGAATCTCGAGATTCCTAATGATGGTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-2129s21c1
Sequence:CCGGGTAATCGAGACACTTACTTTCCTCGAGGAAAGTAAGTGTCTCGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004629
VALIDATED
FANCG MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group G
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-2494s1c1
Sequence:CCGGCCTGTGAAATTTGCCCTAGTTCTCGAGAACTAGGGCAAATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-2340s1c1
Sequence:CCGGGCCAAAGTCTTGTGACCTGTACTCGAGTACAGGTCACAAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-1009s1c1
Sequence:CCGGGCCTCTAAGGATCTGCTGTTACTCGAGTAACAGCAGATCCTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-1056s1c1
Sequence:CCGGTGAGGAATTAGATGCTCCATTCTCGAGAATGGAGCATCTAATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004629.1-1418s1c1
Sequence:CCGGCCTTGAATGTCCCATGCAGTTCTCGAGAACTGCATGGGACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-1395s21c1
Sequence:CCGGGAGTCTGGAGCTGCTAGTTGACTCGAGTCAACTAGCAGCTCCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-2159s21c1
Sequence:CCGGAGACTCTGAAGAGGCTAGATCCTCGAGGATCTAGCCTCTTCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-1295s21c1
Sequence:CCGGACTTGGTTGCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGCAACCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004629.1-2427s21c1
Sequence:CCGGTGCTTCACCATCATTAGGAATCTCGAGATTCCTAATGATGGTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-2129s21c1
Sequence:CCGGGTAATCGAGACACTTACTTTCCTCGAGGAAAGTAAGTGTCTCGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004629
VALIDATED
FANCG MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group G
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-2494s1c1
Sequence:CCGGCCTGTGAAATTTGCCCTAGTTCTCGAGAACTAGGGCAAATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-2340s1c1
Sequence:CCGGGCCAAAGTCTTGTGACCTGTACTCGAGTACAGGTCACAAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-1009s1c1
Sequence:CCGGGCCTCTAAGGATCTGCTGTTACTCGAGTAACAGCAGATCCTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004629.1-1056s1c1
Sequence:CCGGTGAGGAATTAGATGCTCCATTCTCGAGAATGGAGCATCTAATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004629.1-1418s1c1
Sequence:CCGGCCTTGAATGTCCCATGCAGTTCTCGAGAACTGCATGGGACATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-1395s21c1
Sequence:CCGGGAGTCTGGAGCTGCTAGTTGACTCGAGTCAACTAGCAGCTCCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-2159s21c1
Sequence:CCGGAGACTCTGAAGAGGCTAGATCCTCGAGGATCTAGCCTCTTCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-1295s21c1
Sequence:CCGGACTTGGTTGCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGCAACCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004629.1-2427s21c1
Sequence:CCGGTGCTTCACCATCATTAGGAATCTCGAGATTCCTAATGATGGTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004629.1-2129s21c1
Sequence:CCGGGTAATCGAGACACTTACTTTCCTCGAGGAAAGTAAGTGTCTCGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053081
VALIDATED
FANCG MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group G
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-821s1c1
Sequence:CCGGGCACTGTTGTACTTGACTGAACTCGAGTTCAGTCAAGTACAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-507s1c1
Sequence:CCGGCCTTGCTGTTACAAACCCTAACTCGAGTTAGGGTTTGTAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-88s1c1
Sequence:CCGGCCAGCTTGTTAGACAGGCTAACTCGAGTTAGCCTGTCTAACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-1773s1c1
Sequence:CCGGCCGGGTCTCTTCCACTGTATTCTCGAGAATACAGTGGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-1459s1c1
Sequence:CCGGCCAGTGTCTTGAGCTGCTCTTCTCGAGAAGAGCAGCTCAAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-553s21c1
Sequence:CCGGGGATCTGCTACTACTGCTAAACTCGAGTTTAGCAGTAGTAGCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-507s21c1
Sequence:CCGGCCTTGCTGTTACAAACCCTAACTCGAGTTAGGGTTTGTAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-1773s21c1
Sequence:CCGGCCGGGTCTCTTCCACTGTATTCTCGAGAATACAGTGGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-1459s21c1
Sequence:CCGGCCAGTGTCTTGAGCTGCTCTTCTCGAGAAGAGCAGCTCAAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-821s21c1
Sequence:CCGGGCACTGTTGTACTTGACTGAACTCGAGTTCAGTCAAGTACAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053081
VALIDATED
FANCG MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group G
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-821s1c1
Sequence:CCGGGCACTGTTGTACTTGACTGAACTCGAGTTCAGTCAAGTACAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-507s1c1
Sequence:CCGGCCTTGCTGTTACAAACCCTAACTCGAGTTAGGGTTTGTAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-88s1c1
Sequence:CCGGCCAGCTTGTTAGACAGGCTAACTCGAGTTAGCCTGTCTAACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-1773s1c1
Sequence:CCGGCCGGGTCTCTTCCACTGTATTCTCGAGAATACAGTGGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-1459s1c1
Sequence:CCGGCCAGTGTCTTGAGCTGCTCTTCTCGAGAAGAGCAGCTCAAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-553s21c1
Sequence:CCGGGGATCTGCTACTACTGCTAAACTCGAGTTTAGCAGTAGTAGCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-507s21c1
Sequence:CCGGCCTTGCTGTTACAAACCCTAACTCGAGTTAGGGTTTGTAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-1773s21c1
Sequence:CCGGCCGGGTCTCTTCCACTGTATTCTCGAGAATACAGTGGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-1459s21c1
Sequence:CCGGCCAGTGTCTTGAGCTGCTCTTCTCGAGAAGAGCAGCTCAAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-821s21c1
Sequence:CCGGGCACTGTTGTACTTGACTGAACTCGAGTTCAGTCAAGTACAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053081
VALIDATED
FANCG MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group G
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-821s1c1
Sequence:CCGGGCACTGTTGTACTTGACTGAACTCGAGTTCAGTCAAGTACAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-507s1c1
Sequence:CCGGCCTTGCTGTTACAAACCCTAACTCGAGTTAGGGTTTGTAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-88s1c1
Sequence:CCGGCCAGCTTGTTAGACAGGCTAACTCGAGTTAGCCTGTCTAACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-1773s1c1
Sequence:CCGGCCGGGTCTCTTCCACTGTATTCTCGAGAATACAGTGGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053081.1-1459s1c1
Sequence:CCGGCCAGTGTCTTGAGCTGCTCTTCTCGAGAAGAGCAGCTCAAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-553s21c1
Sequence:CCGGGGATCTGCTACTACTGCTAAACTCGAGTTTAGCAGTAGTAGCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-507s21c1
Sequence:CCGGCCTTGCTGTTACAAACCCTAACTCGAGTTAGGGTTTGTAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-1773s21c1
Sequence:CCGGCCGGGTCTCTTCCACTGTATTCTCGAGAATACAGTGGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-1459s21c1
Sequence:CCGGCCAGTGTCTTGAGCTGCTCTTCTCGAGAAGAGCAGCTCAAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053081.1-821s21c1
Sequence:CCGGGCACTGTTGTACTTGACTGAACTCGAGTTCAGTCAAGTACAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks