EMAIL THIS PAGE TO A FRIEND

FANCI

Fanconi anemia, complementation group I

86 Gene Product Result for
Synonyms: KIAA1794
Gene ID:
Human(55215) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(208836) Fanconi anemia, complementation group I
Rat(100360594) Fanconi anemia, complementation group I
sheep(101103510) Fanconi anemia, complementation group I
Domestic Rabbit(100347941) Fanconi anemia, complementation group I
naked mole-rat(101701516) Fanconi anemia, complementation group I
domestic guinea pig(100731127) Fanconi anemia, complementation group I
Zebrafish(324185) Fanconi anemia, complementation group I
cow(522442) Fanconi anemia, complementation group I
Horse(100069712) Fanconi anemia, complementation group I
domestic cat(101091115) Fanconi anemia, complementation group I
dog(488731) Fanconi anemia, complementation group I
chicken(415491) Fanconi anemia, complementation group I
fruit fly(35895) Fanconi anemia complementation group I homologue
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018193 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113378 Rosetta Predictions human pricing
NM_018193 Rosetta Predictions human pricing
NM_145946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325751 predicted 3604
2 SASI_Hs02_00325752 predicted 843
3 SASI_Hs02_00325753 predicted 606
4 SASI_Hs02_00325754 predicted 692
5 SASI_Hs02_00325755 predicted 1488
6 SASI_Hs02_00325756 predicted 712
7 SASI_Hs02_00325757 predicted 3202
8 SASI_Hs02_00325758 predicted 1430
9 SASI_Hs02_00325759 predicted 3385
10 SASI_Hs02_00325760 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179936 predicted 3424
2 SASI_Hs01_00179937 predicted 840
3 SASI_Hs01_00179938 predicted 611
4 SASI_Hs02_00351463 predicted 695
5 SASI_Hs01_00179939 predicted 1485
6 SASI_Hs02_00351464 predicted 720
7 SASI_Hs01_00179940 predicted 3018
8 SASI_Hs02_00351465 predicted 1423
9 SASI_Hs01_00179941 predicted 3204
10 SASI_Hs01_00179942 predicted 393
11 SASI_Hs01_00179935 predicted 3284
12 SASI_Hs01_00179943 predicted 3649
13 SASI_Hs01_00179944 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341406 predicted 1431
2 SASI_Mm01_00066159 predicted 1462
3 SASI_Mm01_00066161 predicted 1141
4 SASI_Mm02_00341407 predicted 3901
5 SASI_Mm02_00341408 predicted 2448
6 SASI_Mm01_00066166 predicted 534
7 SASI_Mm02_00341409 predicted 1276
8 SASI_Mm02_00341410 predicted 3909
9 SASI_Mm02_00341411 predicted 3780
10 SASI_Mm02_00341412 predicted 1313
11 SASI_Mm01_00066157 predicted 271
12 SASI_Mm01_00066158 predicted 1204
13 SASI_Mm01_00066160 predicted 775
14 SASI_Mm01_00066162 predicted 399
15 SASI_Mm01_00066163 predicted 312
16 SASI_Mm01_00066164 predicted 541
17 SASI_Mm01_00066165 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145946
VALIDATED
FANCI MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-333s21c1
Sequence:CCGGCAGAGATCATAGGATTACTAACTCGAGTTAGTAATCCTATGATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-1327s21c1
Sequence:CCGGATGTAAGCTGGGAGCTAATATCTCGAGATATTAGCTCCCAGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-170s21c1
Sequence:CCGGCTTCAGAACCAAGCGGTGAAACTCGAGTTTCACCGCTTGGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-4391s21c1
Sequence:CCGGACCTGTAAGACGGTGGAAATTCTCGAGAATTTCCACCGTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-882s21c1
Sequence:CCGGCCGTTATTCTGCACATCGTATCTCGAGATACGATGTGCAGAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-166s1c1
Sequence:CCGGCTTCAGAACCAAGCGGTGAAACTCGAGTTTCACCGCTTGGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145946.1-325s1c1
Sequence:CCGGGCATCAGAGATCATAGGATTACTCGAGTAATCCTATGATCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-878s1c1
Sequence:CCGGCCGTTATTCTGCACATCGTATCTCGAGATACGATGTGCAGAATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-329s1c1
Sequence:CCGGCAGAGATCATAGGATTACTAACTCGAGTTAGTAATCCTATGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145946
VALIDATED
FANCI MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-333s21c1
Sequence:CCGGCAGAGATCATAGGATTACTAACTCGAGTTAGTAATCCTATGATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-1327s21c1
Sequence:CCGGATGTAAGCTGGGAGCTAATATCTCGAGATATTAGCTCCCAGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-170s21c1
Sequence:CCGGCTTCAGAACCAAGCGGTGAAACTCGAGTTTCACCGCTTGGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-4391s21c1
Sequence:CCGGACCTGTAAGACGGTGGAAATTCTCGAGAATTTCCACCGTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-882s21c1
Sequence:CCGGCCGTTATTCTGCACATCGTATCTCGAGATACGATGTGCAGAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-166s1c1
Sequence:CCGGCTTCAGAACCAAGCGGTGAAACTCGAGTTTCACCGCTTGGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145946.1-325s1c1
Sequence:CCGGGCATCAGAGATCATAGGATTACTCGAGTAATCCTATGATCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-878s1c1
Sequence:CCGGCCGTTATTCTGCACATCGTATCTCGAGATACGATGTGCAGAATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-329s1c1
Sequence:CCGGCAGAGATCATAGGATTACTAACTCGAGTTAGTAATCCTATGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145946
VALIDATED
FANCI MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-333s21c1
Sequence:CCGGCAGAGATCATAGGATTACTAACTCGAGTTAGTAATCCTATGATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-1327s21c1
Sequence:CCGGATGTAAGCTGGGAGCTAATATCTCGAGATATTAGCTCCCAGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-170s21c1
Sequence:CCGGCTTCAGAACCAAGCGGTGAAACTCGAGTTTCACCGCTTGGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-4391s21c1
Sequence:CCGGACCTGTAAGACGGTGGAAATTCTCGAGAATTTCCACCGTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145946.2-882s21c1
Sequence:CCGGCCGTTATTCTGCACATCGTATCTCGAGATACGATGTGCAGAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-166s1c1
Sequence:CCGGCTTCAGAACCAAGCGGTGAAACTCGAGTTTCACCGCTTGGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145946.1-325s1c1
Sequence:CCGGGCATCAGAGATCATAGGATTACTCGAGTAATCCTATGATCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-878s1c1
Sequence:CCGGCCGTTATTCTGCACATCGTATCTCGAGATACGATGTGCAGAATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145946.1-329s1c1
Sequence:CCGGCAGAGATCATAGGATTACTAACTCGAGTTAGTAATCCTATGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018193
VALIDATED
FANCI MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group I
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-1344s21c1
Sequence:CCGGATGTAAGCTCGGAGCTAATATCTCGAGATATTAGCTCCGAGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-886s21c1
Sequence:CCGGCATGTGGAAGGCACCATTATTCTCGAGAATAATGGTGCCTTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-1147s21c1
Sequence:CCGGCTAGTTCCTCATAGATCTTATCTCGAGATAAGATCTATGAGGAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018193.2-3071s21c1
Sequence:CCGGACGGGCATCTGGGAGATATAGCTCGAGCTATATCTCCCAGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-4379s21c1
Sequence:CCGGCAATTGCCACGAACGGTAATGCTCGAGCATTACCGTTCGTGGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018193.1-2417s1c1
Sequence:CCGGCCCTGTGTTATTCTTTCATTTCTCGAGAAATGAAAGAATAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018193.1-696s1c1
Sequence:CCGGCCATTACAATTCTGTCGCCAACTCGAGTTGGCGACAGAATTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018193
VALIDATED
FANCI MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group I
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-1344s21c1
Sequence:CCGGATGTAAGCTCGGAGCTAATATCTCGAGATATTAGCTCCGAGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-886s21c1
Sequence:CCGGCATGTGGAAGGCACCATTATTCTCGAGAATAATGGTGCCTTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-1147s21c1
Sequence:CCGGCTAGTTCCTCATAGATCTTATCTCGAGATAAGATCTATGAGGAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018193.2-3071s21c1
Sequence:CCGGACGGGCATCTGGGAGATATAGCTCGAGCTATATCTCCCAGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-4379s21c1
Sequence:CCGGCAATTGCCACGAACGGTAATGCTCGAGCATTACCGTTCGTGGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018193.1-2417s1c1
Sequence:CCGGCCCTGTGTTATTCTTTCATTTCTCGAGAAATGAAAGAATAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018193.1-696s1c1
Sequence:CCGGCCATTACAATTCTGTCGCCAACTCGAGTTGGCGACAGAATTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018193
VALIDATED
FANCI MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group I
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-1344s21c1
Sequence:CCGGATGTAAGCTCGGAGCTAATATCTCGAGATATTAGCTCCGAGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-886s21c1
Sequence:CCGGCATGTGGAAGGCACCATTATTCTCGAGAATAATGGTGCCTTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-1147s21c1
Sequence:CCGGCTAGTTCCTCATAGATCTTATCTCGAGATAAGATCTATGAGGAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018193.2-3071s21c1
Sequence:CCGGACGGGCATCTGGGAGATATAGCTCGAGCTATATCTCCCAGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018193.2-4379s21c1
Sequence:CCGGCAATTGCCACGAACGGTAATGCTCGAGCATTACCGTTCGTGGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018193.1-2417s1c1
Sequence:CCGGCCCTGTGTTATTCTTTCATTTCTCGAGAAATGAAAGAATAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018193.1-696s1c1
Sequence:CCGGCCATTACAATTCTGTCGCCAACTCGAGTTGGCGACAGAATTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks