EMAIL THIS PAGE TO A FRIEND

FANCL

Fanconi anemia, complementation group L

108 Gene Product Result for
Synonyms: FAAP43 PHF9 POG
UniProtKB ID: Q9NW38, Q6GU60
Gene ID:
Human(55120) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group L. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(67030) Fanconi anemia, complementation group L
Rat(305600) Fanconi anemia, complementation group L
Zebrafish(406255) Fanconi anemia, complementation group L
domestic cat(101097311) Fanconi anemia, complementation group L
cow(614512) Fanconi anemia, complementation group L
Horse(100065770) Fanconi anemia, complementation group L
dog(612161) Fanconi anemia, complementation group L
chicken(421202) Fanconi anemia, complementation group L
fruit fly(41231) CG12812 gene product from transcript CG12812-RA
domestic guinea pig(100720230) Fanconi anemia, complementation group L
naked mole-rat(101702870) Fanconi anemia, complementation group L
sheep(101119628) Fanconi anemia, complementation group L
Domestic Rabbit(100344973) Fanconi anemia, complementation group L
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0708 AQUA Peptide DT(CAM)FSTEGPNLVT[R] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114636 Rosetta Predictions human pricing
NM_018062 Rosetta Predictions human pricing
XM_001064256 Rosetta Predictions rat pricing
XM_223701 Rosetta Predictions rat pricing
NM_025923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326744 predicted 251
2 SASI_Hs02_00326745 predicted 1157
3 SASI_Hs02_00326746 predicted 304
4 SASI_Hs02_00326747 predicted 350
5 SASI_Hs02_00326748 predicted 299
6 SASI_Hs02_00326749 predicted 1156
7 SASI_Hs02_00326750 predicted 1105
8 SASI_Hs02_00326751 predicted 884
9 SASI_Hs02_00326752 predicted 258
10 SASI_Hs02_00326753 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098297 predicted 256
2 SASI_Hs01_00098298 predicted 1151
3 SASI_Hs01_00098299 predicted 310
4 SASI_Hs01_00098300 predicted 351
5 SASI_Hs01_00098302 predicted 293
6 SASI_Hs01_00098303 predicted 1141
7 SASI_Hs01_00098304 predicted 1091
8 SASI_Hs02_00351202 predicted 869
9 SASI_Hs02_00351203 predicted 264
10 SASI_Hs02_00351204 predicted 282
11 SASI_Hs01_00098296 predicted 547
12 SASI_Hs01_00098301 predicted 1017
13 SASI_Hs01_00098305 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309814 predicted 1562
2 SASI_Rn02_00309815 predicted 670
3 SASI_Rn02_00309816 predicted 661
4 SASI_Rn02_00309817 predicted 1385
5 SASI_Rn02_00309818 predicted 577
6 SASI_Rn02_00309819 predicted 405
7 SASI_Rn02_00309820 predicted 617
8 SASI_Rn02_00309821 predicted 1421
9 SASI_Rn02_00309822 predicted 706
10 SASI_Rn02_00309823 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381590 predicted 1563
2 SASI_Rn02_00381591 predicted 673
3 SASI_Rn02_00381592 predicted 653
4 SASI_Rn02_00381593 predicted 1391
5 SASI_Rn02_00381594 predicted 570
6 SASI_Rn02_00381595 predicted 410
7 SASI_Rn02_00381596 predicted 620
8 SASI_Rn02_00381597 predicted 1427
9 SASI_Rn02_00381598 predicted 703
10 SASI_Rn02_00381599 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156526 predicted 399
2 SASI_Mm01_00156527 predicted 724
3 SASI_Mm01_00156528 predicted 457
4 SASI_Mm01_00156529 predicted 808
5 SASI_Mm01_00156530 predicted 240
6 SASI_Mm01_00156531 predicted 1007
7 SASI_Mm01_00156532 predicted 857
8 SASI_Mm01_00156533 predicted 437
9 SASI_Mm01_00156534 predicted 348
10 SASI_Mm01_00156535 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018062
VALIDATED
FANCL MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group L
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-159s1c1
Sequence:CCGGGCCTGAAGATTTACAACTGAACTCGAGTTCAGTTGTAAATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-831s1c1
Sequence:CCGGGCTGAGCAGGAACATACATTTCTCGAGAAATGTATGTTCCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-710s1c1
Sequence:CCGGGCAGAATTGCATTAGGTAATACTCGAGTATTACCTAATGCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-371s1c1
Sequence:CCGGGCCTTATTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-1027s1c1
Sequence:CCGGCCTTTCCATCAAATATGCTTACTCGAGTAAGCATATTTGATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018062.3-544s21c1
Sequence:CCGGTGCAGAATCACCAGATTATTTCTCGAGAAATAATCTGGTGATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018062.3-744s21c1
Sequence:CCGGGCAGAATTGCATTAGGTAATACTCGAGTATTACCTAATGCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018062.3-405s21c1
Sequence:CCGGGCCTTATTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018062.3-865s21c1
Sequence:CCGGGCTGAGCAGGAACATACATTTCTCGAGAAATGTATGTTCCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018062
VALIDATED
FANCL MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group L
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-159s1c1
Sequence:CCGGGCCTGAAGATTTACAACTGAACTCGAGTTCAGTTGTAAATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-831s1c1
Sequence:CCGGGCTGAGCAGGAACATACATTTCTCGAGAAATGTATGTTCCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-710s1c1
Sequence:CCGGGCAGAATTGCATTAGGTAATACTCGAGTATTACCTAATGCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-371s1c1
Sequence:CCGGGCCTTATTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-1027s1c1
Sequence:CCGGCCTTTCCATCAAATATGCTTACTCGAGTAAGCATATTTGATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018062.3-544s21c1
Sequence:CCGGTGCAGAATCACCAGATTATTTCTCGAGAAATAATCTGGTGATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018062.3-744s21c1
Sequence:CCGGGCAGAATTGCATTAGGTAATACTCGAGTATTACCTAATGCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018062.3-405s21c1
Sequence:CCGGGCCTTATTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018062.3-865s21c1
Sequence:CCGGGCTGAGCAGGAACATACATTTCTCGAGAAATGTATGTTCCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018062
VALIDATED
FANCL MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group L
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-159s1c1
Sequence:CCGGGCCTGAAGATTTACAACTGAACTCGAGTTCAGTTGTAAATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-831s1c1
Sequence:CCGGGCTGAGCAGGAACATACATTTCTCGAGAAATGTATGTTCCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-710s1c1
Sequence:CCGGGCAGAATTGCATTAGGTAATACTCGAGTATTACCTAATGCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-371s1c1
Sequence:CCGGGCCTTATTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018062.1-1027s1c1
Sequence:CCGGCCTTTCCATCAAATATGCTTACTCGAGTAAGCATATTTGATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018062.3-544s21c1
Sequence:CCGGTGCAGAATCACCAGATTATTTCTCGAGAAATAATCTGGTGATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018062.3-744s21c1
Sequence:CCGGGCAGAATTGCATTAGGTAATACTCGAGTATTACCTAATGCAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018062.3-405s21c1
Sequence:CCGGGCCTTATTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018062.3-865s21c1
Sequence:CCGGGCTGAGCAGGAACATACATTTCTCGAGAAATGTATGTTCCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025923
VALIDATED
FANCL MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group L
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-1011s1c1
Sequence:CCGGGCTCGTAGTATCTTGGAAGAACTCGAGTTCTTCCAAGATACTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-572s1c1
Sequence:CCGGGCACCTAATCACTGTCAAGTTCTCGAGAACTTGACAGTGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-864s1c1
Sequence:CCGGCCTACCATGCTTCCTGAGTTTCTCGAGAAACTCAGGAAGCATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-270s1c1
Sequence:CCGGCAGCTCAAGAAGGCAAGATTACTCGAGTAATCTTGCCTTCTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-673s1c1
Sequence:CCGGGCTCCTTGGTAGATGTTTATACTCGAGTATAAACATCTACCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-864s21c1
Sequence:CCGGCCTACCATGCTTCCTGAGTTTCTCGAGAAACTCAGGAAGCATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-673s21c1
Sequence:CCGGGCTCCTTGGTAGATGTTTATACTCGAGTATAAACATCTACCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-572s21c1
Sequence:CCGGGCACCTAATCACTGTCAAGTTCTCGAGAACTTGACAGTGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-1011s21c1
Sequence:CCGGGCTCGTAGTATCTTGGAAGAACTCGAGTTCTTCCAAGATACTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025923
VALIDATED
FANCL MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group L
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-1011s1c1
Sequence:CCGGGCTCGTAGTATCTTGGAAGAACTCGAGTTCTTCCAAGATACTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-572s1c1
Sequence:CCGGGCACCTAATCACTGTCAAGTTCTCGAGAACTTGACAGTGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-864s1c1
Sequence:CCGGCCTACCATGCTTCCTGAGTTTCTCGAGAAACTCAGGAAGCATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-270s1c1
Sequence:CCGGCAGCTCAAGAAGGCAAGATTACTCGAGTAATCTTGCCTTCTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-673s1c1
Sequence:CCGGGCTCCTTGGTAGATGTTTATACTCGAGTATAAACATCTACCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-864s21c1
Sequence:CCGGCCTACCATGCTTCCTGAGTTTCTCGAGAAACTCAGGAAGCATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-673s21c1
Sequence:CCGGGCTCCTTGGTAGATGTTTATACTCGAGTATAAACATCTACCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-572s21c1
Sequence:CCGGGCACCTAATCACTGTCAAGTTCTCGAGAACTTGACAGTGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-1011s21c1
Sequence:CCGGGCTCGTAGTATCTTGGAAGAACTCGAGTTCTTCCAAGATACTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025923
VALIDATED
FANCL MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group L
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-1011s1c1
Sequence:CCGGGCTCGTAGTATCTTGGAAGAACTCGAGTTCTTCCAAGATACTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-572s1c1
Sequence:CCGGGCACCTAATCACTGTCAAGTTCTCGAGAACTTGACAGTGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-864s1c1
Sequence:CCGGCCTACCATGCTTCCTGAGTTTCTCGAGAAACTCAGGAAGCATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-270s1c1
Sequence:CCGGCAGCTCAAGAAGGCAAGATTACTCGAGTAATCTTGCCTTCTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025923.2-673s1c1
Sequence:CCGGGCTCCTTGGTAGATGTTTATACTCGAGTATAAACATCTACCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-864s21c1
Sequence:CCGGCCTACCATGCTTCCTGAGTTTCTCGAGAAACTCAGGAAGCATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-673s21c1
Sequence:CCGGGCTCCTTGGTAGATGTTTATACTCGAGTATAAACATCTACCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-572s21c1
Sequence:CCGGGCACCTAATCACTGTCAAGTTCTCGAGAACTTGACAGTGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025923.2-1011s21c1
Sequence:CCGGGCTCGTAGTATCTTGGAAGAACTCGAGTTCTTCCAAGATACTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks