EMAIL THIS PAGE TO A FRIEND

FANCM

Fanconi anemia, complementation group M

42 Gene Product Result for
Synonyms: FAAP250 KIAA1596
UniProtKB ID: Q8IYD8, Q3YFH9, Q8N9X6, Q9HCH6
Gene ID:
Human(57697) Summary: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. [provided by RefSeq, Jul 2008]
Mouse(104806) Fanconi anemia, complementation group M
sheep(101106113) Fanconi anemia, complementation group M
naked mole-rat(101713730) Fanconi anemia, complementation group M
domestic guinea pig(100715324) Fanconi anemia, complementation group M
Zebrafish(100006685) Fanconi anemia, complementation group M
cow(513626) Fanconi anemia, complementation group M
Horse(100063761) Fanconi anemia, complementation group M
domestic cat(101086570) Fanconi anemia, complementation group M
dog(480307) Fanconi anemia, complementation group M
chicken(100857997) Fanconi anemia, complementation group M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020937 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_048128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_048128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_048128 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010411 MISSION® esiRNA esiRNA targeting mouse Fancm (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020937 Rosetta Predictions human pricing
NM_178912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115769 predicted 3477
2 SASI_Hs01_00115771 predicted 5496
3 SASI_Hs02_00354326 predicted 5183
4 SASI_Hs01_00115773 predicted 1512
5 SASI_Hs02_00354327 predicted 3428
6 SASI_Hs01_00115774 predicted 3851
7 SASI_Hs02_00354328 predicted 979
8 SASI_Hs02_00354329 predicted 4990
9 SASI_Hs01_00115775 predicted 3466
10 SASI_Hs02_00354330 predicted 754
11 SASI_Hs01_00115770 predicted 4498
12 SASI_Hs01_00115772 predicted 640
13 SASI_Hs01_00115776 predicted 5511
14 SASI_Hs01_00115777 predicted 5555
15 SASI_Hs01_00115778 predicted 5251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349527 predicted 3399
2 SASI_Mm01_00192473 predicted 1258
3 SASI_Mm01_00192474 predicted 3603
4 SASI_Mm01_00192475 predicted 2858
5 SASI_Mm02_00349528 predicted 3586
6 SASI_Mm01_00192477 predicted 4018
7 SASI_Mm01_00192478 predicted 2585
8 SASI_Mm01_00192479 predicted 2096
9 SASI_Mm01_00192480 predicted 947
10 SASI_Mm01_00192481 predicted 5265
11 SASI_Mm01_00192476 predicted 1071
12 SASI_Mm01_00192482 predicted 1113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020937
VALIDATED
FANCM MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group M
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1872s21c1
Sequence:CCGGAGGACGAGAGGAACGTATTTACTCGAGTAAATACGTTCCTCTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020937.2-837s21c1
Sequence:CCGGCACACCAGGTAGTGATATAAACTCGAGTTTATATCACTACCTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020937.2-6488s21c1
Sequence:CCGGAGTGTTACTAAGGATAGTTTACTCGAGTAAACTATCCTTAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1518s21c1
Sequence:CCGGACGTGATGAGACCCGAGTTATCTCGAGATAACTCGGGTCTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1321s21c1
Sequence:CCGGGACTTCATGAAACTCTATAATCTCGAGATTATAGAGTTTCATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020937
VALIDATED
FANCM MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group M
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1872s21c1
Sequence:CCGGAGGACGAGAGGAACGTATTTACTCGAGTAAATACGTTCCTCTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020937.2-837s21c1
Sequence:CCGGCACACCAGGTAGTGATATAAACTCGAGTTTATATCACTACCTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020937.2-6488s21c1
Sequence:CCGGAGTGTTACTAAGGATAGTTTACTCGAGTAAACTATCCTTAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1518s21c1
Sequence:CCGGACGTGATGAGACCCGAGTTATCTCGAGATAACTCGGGTCTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1321s21c1
Sequence:CCGGGACTTCATGAAACTCTATAATCTCGAGATTATAGAGTTTCATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020937
VALIDATED
FANCM MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group M
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1872s21c1
Sequence:CCGGAGGACGAGAGGAACGTATTTACTCGAGTAAATACGTTCCTCTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020937.2-837s21c1
Sequence:CCGGCACACCAGGTAGTGATATAAACTCGAGTTTATATCACTACCTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020937.2-6488s21c1
Sequence:CCGGAGTGTTACTAAGGATAGTTTACTCGAGTAAACTATCCTTAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1518s21c1
Sequence:CCGGACGTGATGAGACCCGAGTTATCTCGAGATAACTCGGGTCTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020937.2-1321s21c1
Sequence:CCGGGACTTCATGAAACTCTATAATCTCGAGATTATAGAGTTTCATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178912
VALIDATED
FANCM MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group M
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.3-836s1c1
Sequence:CCGGGTGATCACTAACCTACTAATTCTCGAGAATTAGTAGGTTAGTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.3-4892s1c1
Sequence:CCGGGATGAGGACATACGATATAAACTCGAGTTTATATCGTATGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.2-1210s1c2
Sequence:CCGGCAAAGAAAGAATGCTGGTATTCTCGAGAATACCAGCATTCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-202s1c1
Sequence:CCGGGCCAATCAAGTGAAGAAGAAACTCGAGTTTCTTCTTCACTTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-1176s1c1
Sequence:CCGGGCAGATTTACTAAAGGAGCCTCTCGAGAGGCTCCTTTAGTAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-74s1c1
Sequence:CCGGGATGAGCACTAAGTACAGAATCTCGAGATTCTGTACTTAGTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178912.2-965s1c1
Sequence:CCGGGTTAAGTAATACCAGCAAGAACTCGAGTTCTTGCTGGTATTACTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178912.2-914s1c1
Sequence:CCGGCTACATCGTAAGCAGCCGAATCTCGAGATTCGGCTGCTTACGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178912
VALIDATED
FANCM MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group M
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.3-836s1c1
Sequence:CCGGGTGATCACTAACCTACTAATTCTCGAGAATTAGTAGGTTAGTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.3-4892s1c1
Sequence:CCGGGATGAGGACATACGATATAAACTCGAGTTTATATCGTATGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.2-1210s1c2
Sequence:CCGGCAAAGAAAGAATGCTGGTATTCTCGAGAATACCAGCATTCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-202s1c1
Sequence:CCGGGCCAATCAAGTGAAGAAGAAACTCGAGTTTCTTCTTCACTTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-1176s1c1
Sequence:CCGGGCAGATTTACTAAAGGAGCCTCTCGAGAGGCTCCTTTAGTAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-74s1c1
Sequence:CCGGGATGAGCACTAAGTACAGAATCTCGAGATTCTGTACTTAGTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178912.2-965s1c1
Sequence:CCGGGTTAAGTAATACCAGCAAGAACTCGAGTTCTTGCTGGTATTACTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178912.2-914s1c1
Sequence:CCGGCTACATCGTAAGCAGCCGAATCTCGAGATTCGGCTGCTTACGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178912
VALIDATED
FANCM MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group M
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.3-836s1c1
Sequence:CCGGGTGATCACTAACCTACTAATTCTCGAGAATTAGTAGGTTAGTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.3-4892s1c1
Sequence:CCGGGATGAGGACATACGATATAAACTCGAGTTTATATCGTATGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178912.2-1210s1c2
Sequence:CCGGCAAAGAAAGAATGCTGGTATTCTCGAGAATACCAGCATTCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-202s1c1
Sequence:CCGGGCCAATCAAGTGAAGAAGAAACTCGAGTTTCTTCTTCACTTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-1176s1c1
Sequence:CCGGGCAGATTTACTAAAGGAGCCTCTCGAGAGGCTCCTTTAGTAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178912.2-74s1c1
Sequence:CCGGGATGAGCACTAAGTACAGAATCTCGAGATTCTGTACTTAGTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178912.2-965s1c1
Sequence:CCGGGTTAAGTAATACCAGCAAGAACTCGAGTTCTTGCTGGTATTACTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178912.2-914s1c1
Sequence:CCGGCTACATCGTAAGCAGCCGAATCTCGAGATTCGGCTGCTTACGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_048128
VALIDATED
FANCM MISSION shRNA Bacterial Glycerol Stock
Fanconi anemia, complementation group M
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000051353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048128.9-5801s1c1
Sequence:CCGGCCAAGAAGAAACCGCAGATTTCTCGAGAAATCTGCGGTTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_048128.9-1522s1c1
Sequence:CCGGCCCGAGTTATGATCTTCTCTTCTCGAGAAGAGAAGATCATAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_048128.9-747s1c1
Sequence:CCGGGCTCTCGGAAACTATGCTTATCTCGAGATAAGCATAGTTTCCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048128.9-3577s1c1
Sequence:CCGGCCTTTGATTTAGGATTCTGTACTCGAGTACAGAATCCTAAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_048128
VALIDATED
FANCM MISSION shRNA shRNA Plasmid DNA
Fanconi anemia, complementation group M
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000051353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048128.9-5801s1c1
Sequence:CCGGCCAAGAAGAAACCGCAGATTTCTCGAGAAATCTGCGGTTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_048128.9-1522s1c1
Sequence:CCGGCCCGAGTTATGATCTTCTCTTCTCGAGAAGAGAAGATCATAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_048128.9-747s1c1
Sequence:CCGGGCTCTCGGAAACTATGCTTATCTCGAGATAAGCATAGTTTCCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048128.9-3577s1c1
Sequence:CCGGCCTTTGATTTAGGATTCTGTACTCGAGTACAGAATCCTAAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_048128
VALIDATED
FANCM MISSION shRNA Lentiviral Transduction Particles
Fanconi anemia, complementation group M
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000051353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048128.9-5801s1c1
Sequence:CCGGCCAAGAAGAAACCGCAGATTTCTCGAGAAATCTGCGGTTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_048128.9-1522s1c1
Sequence:CCGGCCCGAGTTATGATCTTCTCTTCTCGAGAAGAGAAGATCATAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_048128.9-747s1c1
Sequence:CCGGGCTCTCGGAAACTATGCTTATCTCGAGATAAGCATAGTTTCCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048128.9-3577s1c1
Sequence:CCGGCCTTTGATTTAGGATTCTGTACTCGAGTACAGAATCCTAAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks