EMAIL THIS PAGE TO A FRIEND

FANK1

fibronectin type III and ankyrin repeat domains 1

60 Gene Product Result for
UniProtKB ID: Q8TC84, Q6UXY9, Q6X7T6
Gene ID:
Mouse(66930) fibronectin type 3 and ankyrin repeat domains 1
Rat(309071) fibronectin type 3 and ankyrin repeat domains 1
Zebrafish(100005699) fibronectin type III and ankyrin repeat domains 1
cow(445423) fibronectin type III and ankyrin repeat domains 1
domestic cat(101081085) fibronectin type III and ankyrin repeat domains 1
dog(611459) fibronectin type III and ankyrin repeat domains 1
sheep(101116440) fibronectin type III and ankyrin repeat domains 1
Domestic Rabbit(100341126) fibronectin type III and ankyrin repeat domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145235 Rosetta Predictions human pricing
NM_001008347 Rosetta Predictions rat pricing
NM_025850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170155 predicted 396
2 SASI_Hs01_00170156 predicted 263
3 SASI_Hs01_00170158 predicted 661
4 SASI_Hs01_00170159 predicted 330
5 SASI_Hs01_00170160 predicted 565
6 SASI_Hs01_00170161 predicted 325
7 SASI_Hs01_00170162 predicted 218
8 SASI_Hs01_00170163 predicted 228
9 SASI_Hs01_00170164 predicted 280
10 SASI_Hs02_00365074 predicted 200
11 SASI_Hs01_00170157 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114539 predicted 196
2 SASI_Rn01_00114540 predicted 506
3 SASI_Rn02_00199099 predicted 812
4 SASI_Rn01_00114541 predicted 386
5 SASI_Rn01_00114542 predicted 467
6 SASI_Rn01_00114543 predicted 439
7 SASI_Rn01_00114544 predicted 605
8 SASI_Rn01_00114545 predicted 233
9 SASI_Rn01_00114546 predicted 294
10 SASI_Rn01_00114548 predicted 262
11 SASI_Rn01_00114547 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098013 predicted 236
2 SASI_Mm01_00098014 predicted 521
3 SASI_Mm01_00098015 predicted 758
4 SASI_Mm01_00098016 predicted 730
5 SASI_Mm01_00098017 predicted 285
6 SASI_Mm01_00098018 predicted 386
7 SASI_Mm01_00098019 predicted 546
8 SASI_Mm01_00098021 predicted 426
9 SASI_Mm01_00098022 predicted 254
10 SASI_Mm02_00329130 predicted 536
11 SASI_Mm01_00098020 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145235
FANK1 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and ankyrin repeat domains 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-341s1c1
Sequence:CCGGGCTGTACAGATTTCGCCTGAACTCGAGTTCAGGCGAAATCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145235.2-1187s1c1
Sequence:CCGGCCGTGACTGTTAAACTAGGGACTCGAGTCCCTAGTTTAACAGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-272s1c1
Sequence:CCGGGCACACTTATGGTATCATTTACTCGAGTAAATGATACCATAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-984s1c1
Sequence:CCGGGTTCAGTTACTTCTTGACAAACTCGAGTTTGTCAAGAAGTAACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-1080s1c1
Sequence:CCGGGTAGTCTCCTTATTAGAAGAACTCGAGTTCTTCTAATAAGGAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145235.3-878s21c1
Sequence:CCGGGAGGGTGGCCTCTCTTCTAATCTCGAGATTAGAAGAGAGGCCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145235.3-598s21c1
Sequence:CCGGCTAATGGCACAGACGTGAATCCTCGAGGATTCACGTCTGTGCCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145235
FANK1 MISSION shRNA shRNA Plasmid DNA
fibronectin type III and ankyrin repeat domains 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-341s1c1
Sequence:CCGGGCTGTACAGATTTCGCCTGAACTCGAGTTCAGGCGAAATCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145235.2-1187s1c1
Sequence:CCGGCCGTGACTGTTAAACTAGGGACTCGAGTCCCTAGTTTAACAGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-272s1c1
Sequence:CCGGGCACACTTATGGTATCATTTACTCGAGTAAATGATACCATAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-984s1c1
Sequence:CCGGGTTCAGTTACTTCTTGACAAACTCGAGTTTGTCAAGAAGTAACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-1080s1c1
Sequence:CCGGGTAGTCTCCTTATTAGAAGAACTCGAGTTCTTCTAATAAGGAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145235.3-878s21c1
Sequence:CCGGGAGGGTGGCCTCTCTTCTAATCTCGAGATTAGAAGAGAGGCCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145235.3-598s21c1
Sequence:CCGGCTAATGGCACAGACGTGAATCCTCGAGGATTCACGTCTGTGCCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145235
FANK1 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and ankyrin repeat domains 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-341s1c1
Sequence:CCGGGCTGTACAGATTTCGCCTGAACTCGAGTTCAGGCGAAATCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145235.2-1187s1c1
Sequence:CCGGCCGTGACTGTTAAACTAGGGACTCGAGTCCCTAGTTTAACAGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-272s1c1
Sequence:CCGGGCACACTTATGGTATCATTTACTCGAGTAAATGATACCATAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-984s1c1
Sequence:CCGGGTTCAGTTACTTCTTGACAAACTCGAGTTTGTCAAGAAGTAACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145235.2-1080s1c1
Sequence:CCGGGTAGTCTCCTTATTAGAAGAACTCGAGTTCTTCTAATAAGGAGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145235.3-878s21c1
Sequence:CCGGGAGGGTGGCCTCTCTTCTAATCTCGAGATTAGAAGAGAGGCCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145235.3-598s21c1
Sequence:CCGGCTAATGGCACAGACGTGAATCCTCGAGGATTCACGTCTGTGCCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025850
FANK1 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and ankyrin repeat domains 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025850.2-1253s1c1
Sequence:CCGGCCCACATTGAAATACATCTTTCTCGAGAAAGATGTATTTCAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-388s1c1
Sequence:CCGGGCCCATAAGTAGCGAACACTTCTCGAGAAGTGTTCGCTACTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-289s1c1
Sequence:CCGGCCTAGAACCAAGGACACTATACTCGAGTATAGTGTCCTTGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-920s1c1
Sequence:CCGGGCTGTCTTAAATAATCACGAACTCGAGTTCGTGATTATTTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-244s1c1
Sequence:CCGGCGGTGTCATTTACACGGGTTACTCGAGTAACCCGTGTAAATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-128s21c1
Sequence:CCGGACTCATCACAGCATCGAATTGCTCGAGCAATTCGATGCTGTGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-632s21c1
Sequence:CCGGCACCTAGATGTTGTCAAATACCTCGAGGTATTTGACAACATCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-876s21c1
Sequence:CCGGACGTGAACATCAAGGACAAAGCTCGAGCTTTGTCCTTGATGTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025850
FANK1 MISSION shRNA shRNA Plasmid DNA
fibronectin type III and ankyrin repeat domains 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025850.2-1253s1c1
Sequence:CCGGCCCACATTGAAATACATCTTTCTCGAGAAAGATGTATTTCAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-388s1c1
Sequence:CCGGGCCCATAAGTAGCGAACACTTCTCGAGAAGTGTTCGCTACTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-289s1c1
Sequence:CCGGCCTAGAACCAAGGACACTATACTCGAGTATAGTGTCCTTGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-920s1c1
Sequence:CCGGGCTGTCTTAAATAATCACGAACTCGAGTTCGTGATTATTTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-244s1c1
Sequence:CCGGCGGTGTCATTTACACGGGTTACTCGAGTAACCCGTGTAAATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-128s21c1
Sequence:CCGGACTCATCACAGCATCGAATTGCTCGAGCAATTCGATGCTGTGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-632s21c1
Sequence:CCGGCACCTAGATGTTGTCAAATACCTCGAGGTATTTGACAACATCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-876s21c1
Sequence:CCGGACGTGAACATCAAGGACAAAGCTCGAGCTTTGTCCTTGATGTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025850
FANK1 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and ankyrin repeat domains 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025850.2-1253s1c1
Sequence:CCGGCCCACATTGAAATACATCTTTCTCGAGAAAGATGTATTTCAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-388s1c1
Sequence:CCGGGCCCATAAGTAGCGAACACTTCTCGAGAAGTGTTCGCTACTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-289s1c1
Sequence:CCGGCCTAGAACCAAGGACACTATACTCGAGTATAGTGTCCTTGGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-920s1c1
Sequence:CCGGGCTGTCTTAAATAATCACGAACTCGAGTTCGTGATTATTTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025850.2-244s1c1
Sequence:CCGGCGGTGTCATTTACACGGGTTACTCGAGTAACCCGTGTAAATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-128s21c1
Sequence:CCGGACTCATCACAGCATCGAATTGCTCGAGCAATTCGATGCTGTGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-632s21c1
Sequence:CCGGCACCTAGATGTTGTCAAATACCTCGAGGTATTTGACAACATCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025850.2-876s21c1
Sequence:CCGGACGTGAACATCAAGGACAAAGCTCGAGCTTTGTCCTTGATGTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks