EMAIL THIS PAGE TO A FRIEND

FAP

fibroblast activation protein, alpha

63 Gene Product Result for
Synonyms: DPPIV FAPA
UniProtKB ID: Q12884, O00199, Q53TP5, Q86Z29, Q99998, Q9UID4
Gene ID:
Human(2191) Summary: The protein encoded by this gene is a homodimeric integral membrane gelatinase belonging to the serine protease family. It is selectively expressed in reactive stromal fibroblasts of epithelial cancers, granulation tissue of healing wounds, and malignant cells of bone and soft tissue sarcomas. This protein is thought to be involved in the control of fibroblast growth or epithelial-mesenchymal interactions during development, tissue repair, and epithelial carcinogenesis. [provided by RefSeq, Jul 2008]
Mouse(14089) fibroblast activation protein
Rat(192203) fibroblast activation protein, alpha
Zebrafish(565888) fibroblast activation protein, alpha
cow(508882) fibroblast activation protein, alpha
Horse(100051480) fibroblast activation protein, alpha
fruit fly(44514) female abdomen pattern
domestic cat(101098974) fibroblast activation protein, alpha
dog(608176) fibroblast activation protein, alpha
chicken(424186) fibroblast activation protein, alpha
sheep(101106492) fibroblast activation protein, alpha
domestic guinea pig(100720566) fibroblast activation protein, alpha
naked mole-rat(101722237) fibroblast activation protein, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086071 MISSION® esiRNA esiRNA human FAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004460 Rosetta Predictions human pricing
NM_138850 Rosetta Predictions rat pricing
NM_007986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227289 predicted 911
2 SASI_Hs02_00337654 predicted 1185
3 SASI_Hs01_00227290 predicted 991
4 SASI_Hs01_00227291 predicted 573
5 SASI_Hs01_00227292 predicted 1794
6 SASI_Hs01_00227293 predicted 879
7 SASI_Hs01_00227295 predicted 1959
8 SASI_Hs01_00227296 predicted 255
9 SASI_Hs01_00227297 predicted 1305
10 SASI_Hs01_00227298 predicted 1101
11 SASI_Hs01_00227294 predicted 2345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040985 predicted 733
2 SASI_Rn01_00040988 predicted 934
3 SASI_Rn02_00268241 predicted 1824
4 SASI_Rn02_00268242 predicted 2016
5 SASI_Rn01_00040989 predicted 1191
6 SASI_Rn01_00040990 predicted 1235
7 SASI_Rn02_00268243 predicted 1373
8 SASI_Rn01_00040991 predicted 1266
9 SASI_Rn01_00040992 predicted 1004
10 SASI_Rn01_00040993 predicted 1289
11 SASI_Rn01_00040986 predicted 1881
12 SASI_Rn01_00040987 predicted 256
13 SASI_Rn01_00040994 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312897 predicted 1104
2 SASI_Mm01_00143291 predicted 2295
3 SASI_Mm01_00143292 predicted 896
4 SASI_Mm01_00143293 predicted 495
5 SASI_Mm01_00143294 predicted 473
6 SASI_Mm01_00143296 predicted 212
7 SASI_Mm02_00312898 predicted 1741
8 SASI_Mm01_00143298 predicted 2462
9 SASI_Mm01_00143299 predicted 1432
10 SASI_Mm02_00312899 predicted 1658
11 SASI_Mm01_00143290 predicted 1801
12 SASI_Mm01_00143295 predicted 650
13 SASI_Mm01_00143297 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004460
FAP MISSION shRNA Bacterial Glycerol Stock
fibroblast activation protein, alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-890s21c1
Sequence:CCGGGATACGGATATACCAGTTATTCTCGAGAATAACTGGTATATCCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-2221s21c1
Sequence:CCGGTGATAATCTTGAGCACTATAACTCGAGTTATAGTGCTCAAGATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-984s21c1
Sequence:CCGGATCCCGTTGTTCGGATATTTACTCGAGTAAATATCCGAACAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-276s1c1
Sequence:CCGGGCATTGTCTTACGCCCTTCAACTCGAGTTGAAGGGCGTAAGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004460.2-2542s1c1
Sequence:CCGGCCCTCAGACAGTTTGCTTATTCTCGAGAATAAGCAAACTGTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-927s1c1
Sequence:CCGGGCGATGAACAATATCCTAGAACTCGAGTTCTAGGATATTGTTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-879s1c1
Sequence:CCGGCGGAATTTAATGATACGGATACTCGAGTATCCGTATCATTAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-1811s1c1
Sequence:CCGGCCCTTGCTAATTCAAGTGTATCTCGAGATACACTTGAATTAGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004460
FAP MISSION shRNA shRNA Plasmid DNA
fibroblast activation protein, alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-890s21c1
Sequence:CCGGGATACGGATATACCAGTTATTCTCGAGAATAACTGGTATATCCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-2221s21c1
Sequence:CCGGTGATAATCTTGAGCACTATAACTCGAGTTATAGTGCTCAAGATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-984s21c1
Sequence:CCGGATCCCGTTGTTCGGATATTTACTCGAGTAAATATCCGAACAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-276s1c1
Sequence:CCGGGCATTGTCTTACGCCCTTCAACTCGAGTTGAAGGGCGTAAGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004460.2-2542s1c1
Sequence:CCGGCCCTCAGACAGTTTGCTTATTCTCGAGAATAAGCAAACTGTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-927s1c1
Sequence:CCGGGCGATGAACAATATCCTAGAACTCGAGTTCTAGGATATTGTTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-879s1c1
Sequence:CCGGCGGAATTTAATGATACGGATACTCGAGTATCCGTATCATTAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-1811s1c1
Sequence:CCGGCCCTTGCTAATTCAAGTGTATCTCGAGATACACTTGAATTAGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004460
FAP MISSION shRNA Lentiviral Transduction Particles
fibroblast activation protein, alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-890s21c1
Sequence:CCGGGATACGGATATACCAGTTATTCTCGAGAATAACTGGTATATCCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-2221s21c1
Sequence:CCGGTGATAATCTTGAGCACTATAACTCGAGTTATAGTGCTCAAGATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004460.2-984s21c1
Sequence:CCGGATCCCGTTGTTCGGATATTTACTCGAGTAAATATCCGAACAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-276s1c1
Sequence:CCGGGCATTGTCTTACGCCCTTCAACTCGAGTTGAAGGGCGTAAGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004460.2-2542s1c1
Sequence:CCGGCCCTCAGACAGTTTGCTTATTCTCGAGAATAAGCAAACTGTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-927s1c1
Sequence:CCGGGCGATGAACAATATCCTAGAACTCGAGTTCTAGGATATTGTTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-879s1c1
Sequence:CCGGCGGAATTTAATGATACGGATACTCGAGTATCCGTATCATTAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004460.2-1811s1c1
Sequence:CCGGCCCTTGCTAATTCAAGTGTATCTCGAGATACACTTGAATTAGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007986
FAP MISSION shRNA Bacterial Glycerol Stock
fibroblast activation protein, alpha
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000031324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-873s1c1
Sequence:CCGGGCCTATTCTTATTATGGTGATCTCGAGATCACCATAATAAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-1772s1c1
Sequence:CCGGCCCTTTGCTAATTCAAGTGTACTCGAGTACACTTGAATTAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-2388s1c1
Sequence:CCGGCGCTCCCAGAATCATTTATATCTCGAGATATAAATGATTCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-1360s1c1
Sequence:CCGGCCATATATATATTCCGCGTAACTCGAGTTACGCGGAATATATATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007986
FAP MISSION shRNA shRNA Plasmid DNA
fibroblast activation protein, alpha
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000031324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-873s1c1
Sequence:CCGGGCCTATTCTTATTATGGTGATCTCGAGATCACCATAATAAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-1772s1c1
Sequence:CCGGCCCTTTGCTAATTCAAGTGTACTCGAGTACACTTGAATTAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-2388s1c1
Sequence:CCGGCGCTCCCAGAATCATTTATATCTCGAGATATAAATGATTCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-1360s1c1
Sequence:CCGGCCATATATATATTCCGCGTAACTCGAGTTACGCGGAATATATATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007986
FAP MISSION shRNA Lentiviral Transduction Particles
fibroblast activation protein, alpha
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000031324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-873s1c1
Sequence:CCGGGCCTATTCTTATTATGGTGATCTCGAGATCACCATAATAAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-1772s1c1
Sequence:CCGGCCCTTTGCTAATTCAAGTGTACTCGAGTACACTTGAATTAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-2388s1c1
Sequence:CCGGCGCTCCCAGAATCATTTATATCTCGAGATATAAATGATTCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007986.1-1360s1c1
Sequence:CCGGCCATATATATATTCCGCGTAACTCGAGTTACGCGGAATATATATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks