EMAIL THIS PAGE TO A FRIEND

FAR1

fatty acyl CoA reductase 1

227 Gene Product Result for
Synonyms: MLSTD2 SDR10E1
UniProtKB ID: Q8WVX9, D3DQW8, Q5CZA3
Gene ID:
Mouse(67420) fatty acyl CoA reductase 1
Rat(293173) fatty acyl CoA reductase 1
Zebrafish(406829) fatty acyl CoA reductase 1
cow(525262) fatty acyl CoA reductase 1
domestic cat(101093138) fatty acyl CoA reductase 1
dog(476863) fatty acyl CoA reductase 1
chicken(423028) fatty acyl CoA reductase 1
Thale Cress(827173) protein FAR-RED IMPAIRED RESPONSE 1
Thale Cress(832311) fatty acyl-CoA reductase 1
sheep(101119501) fatty acyl CoA reductase 1
naked mole-rat(101721496) fatty acyl CoA reductase 1
domestic guinea pig(100713905) fatty acyl CoA reductase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017322 Anti-FAR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV50044 Anti-MLSTD2 antibody produced in rabbit IgG fraction of antiserum mouse, canine, rabbit, guinea pig, horse, rat, bovine, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032228 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113031 MISSION® esiRNA esiRNA human FAR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032228 Rosetta Predictions human pricing
NM_001011933 Rosetta Predictions rat pricing
NM_026143 Rosetta Predictions mouse pricing
NM_027379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209276 predicted 1546
2 SASI_Hs02_00359536 predicted 637
3 SASI_Hs01_00209278 predicted 1725
4 SASI_Hs02_00359537 predicted 553
5 SASI_Hs01_00209279 predicted 456
6 SASI_Hs01_00209280 predicted 1730
7 SASI_Hs01_00209281 predicted 1403
8 SASI_Hs01_00209282 predicted 1063
9 SASI_Hs01_00209283 predicted 1641
10 SASI_Hs01_00209285 predicted 748
11 SASI_Hs01_00209277 predicted 1651
12 SASI_Hs01_00209284 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078110 predicted 1320
2 SASI_Rn01_00078112 predicted 617
3 SASI_Rn01_00078113 predicted 1171
4 SASI_Rn01_00078114 predicted 1092
5 SASI_Rn01_00078115 predicted 610
6 SASI_Rn01_00078116 predicted 1176
7 SASI_Rn01_00078117 predicted 1438
8 SASI_Rn01_00078118 predicted 513
9 SASI_Rn01_00078119 predicted 1028
10 SASI_Rn02_00199938 predicted 1126
11 SASI_Rn01_00078111 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090629 predicted 1177
2 SASI_Mm01_00090630 predicted 847
3 SASI_Mm01_00090631 predicted 1631
4 SASI_Mm01_00090632 predicted 1408
5 SASI_Mm01_00090633 predicted 778
6 SASI_Mm02_00329756 predicted 774
7 SASI_Mm01_00090634 predicted 1424
8 SASI_Mm01_00090635 predicted 1104
9 SASI_Mm01_00090636 predicted 1596
10 SASI_Mm01_00090638 predicted 555
11 SASI_Mm01_00090637 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117277 predicted 1083
2 SASI_Mm01_00117278 predicted 759
3 SASI_Mm01_00117279 predicted 1538
4 SASI_Mm01_00117280 predicted 1315
5 SASI_Mm01_00117281 predicted 686
6 SASI_Mm02_00332084 predicted 681
7 SASI_Mm01_00117282 predicted 1332
8 SASI_Mm01_00117283 predicted 1015
9 SASI_Mm01_00117284 predicted 1502
10 SASI_Mm01_00117286 predicted 461
11 SASI_Mm01_00117285 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032228
VALIDATED
FAR1 MISSION shRNA Bacterial Glycerol Stock
fatty acyl CoA reductase 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-1572s1c1
Sequence:CCGGCTTTGTGGTTAGTCTGTGTTACTCGAGTAACACAGACTAACCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-979s1c1
Sequence:CCGGCCAAGAAACATCATGGTGTATCTCGAGATACACCATGATGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032228.4-811s1c1
Sequence:CCGGCCAGGATGGATTGATAACTTTCTCGAGAAAGTTATCAATCCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-460s1c1
Sequence:CCGGGCTGTTCAGTTAAATGTGATTCTCGAGAATCACATTTAACTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-1555s1c1
Sequence:CCGGGCAAGAAATATCTGGTACTTTCTCGAGAAAGTACCAGATATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032228.4-3021s1c1
Sequence:CCGGGCAGTGTATCTGGAGTATGTTCTCGAGAACATACTCCAGATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032228
VALIDATED
FAR1 MISSION shRNA shRNA Plasmid DNA
fatty acyl CoA reductase 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-1572s1c1
Sequence:CCGGCTTTGTGGTTAGTCTGTGTTACTCGAGTAACACAGACTAACCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-979s1c1
Sequence:CCGGCCAAGAAACATCATGGTGTATCTCGAGATACACCATGATGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032228.4-811s1c1
Sequence:CCGGCCAGGATGGATTGATAACTTTCTCGAGAAAGTTATCAATCCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-460s1c1
Sequence:CCGGGCTGTTCAGTTAAATGTGATTCTCGAGAATCACATTTAACTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-1555s1c1
Sequence:CCGGGCAAGAAATATCTGGTACTTTCTCGAGAAAGTACCAGATATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032228.4-3021s1c1
Sequence:CCGGGCAGTGTATCTGGAGTATGTTCTCGAGAACATACTCCAGATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032228
VALIDATED
FAR1 MISSION shRNA Lentiviral Transduction Particles
fatty acyl CoA reductase 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-1572s1c1
Sequence:CCGGCTTTGTGGTTAGTCTGTGTTACTCGAGTAACACAGACTAACCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-979s1c1
Sequence:CCGGCCAAGAAACATCATGGTGTATCTCGAGATACACCATGATGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032228.4-811s1c1
Sequence:CCGGCCAGGATGGATTGATAACTTTCTCGAGAAAGTTATCAATCCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-460s1c1
Sequence:CCGGGCTGTTCAGTTAAATGTGATTCTCGAGAATCACATTTAACTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032228.4-1555s1c1
Sequence:CCGGGCAAGAAATATCTGGTACTTTCTCGAGAAAGTACCAGATATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032228.4-3021s1c1
Sequence:CCGGGCAGTGTATCTGGAGTATGTTCTCGAGAACATACTCCAGATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026143
VALIDATED
FAR1 MISSION shRNA Bacterial Glycerol Stock
fatty acyl CoA reductase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026143.1-975s1c1
Sequence:CCGGGCAGAGCTAACGAGCATAGAACTCGAGTTCTATGCTCGTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026143.1-743s1c1
Sequence:CCGGCGTACATATACACCAAGGCATCTCGAGATGCCTTGGTGTATATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026143.1-897s1c1
Sequence:CCGGGTTTCAAGTTAGAACTGTGTACTCGAGTACACAGTTCTAACTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026143.1-985s1c1
Sequence:CCGGCGAGCATAGAAAGAGGTAATACTCGAGTATTACCTCTTTCTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026143.1-941s1c1
Sequence:CCGGGCAGGTGCTAACATGATGAATCTCGAGATTCATCATGTTAGCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1488s21c1
Sequence:CCGGATATTGATGTACGGCAGTTACCTCGAGGTAACTGCCGTACATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1608s21c1
Sequence:CCGGAGTTGCGGAATATCCGTTATGCTCGAGCATAACGGATATTCCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026143.2-2113s21c1
Sequence:CCGGCTTAACATGAAGTCCTAATATCTCGAGATATTAGGACTTCATGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1636s21c1
Sequence:CCGGTACAATCCTTGTGATACTTATCTCGAGATAAGTATCACAAGGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-773s21c1
Sequence:CCGGATGGATGATGGCCTAGTAAATCTCGAGATTTACTAGGCCATCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-508s21c1
Sequence:CCGGAGAAGATAAGGAGATCATTATCTCGAGATAATGATCTCCTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1879s21c1
Sequence:CCGGTAAATTGGAGCGTGGAGTAAACTCGAGTTTACTCCACGCTCCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1445s21c1
Sequence:CCGGATGTTAATGAACCAACTAAACCTCGAGGTTTAGTTGGTTCATTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026143
VALIDATED
FAR1 MISSION shRNA shRNA Plasmid DNA
fatty acyl CoA reductase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026143.1-975s1c1
Sequence:CCGGGCAGAGCTAACGAGCATAGAACTCGAGTTCTATGCTCGTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026143.1-743s1c1
Sequence:CCGGCGTACATATACACCAAGGCATCTCGAGATGCCTTGGTGTATATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026143.1-897s1c1
Sequence:CCGGGTTTCAAGTTAGAACTGTGTACTCGAGTACACAGTTCTAACTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026143.1-985s1c1
Sequence:CCGGCGAGCATAGAAAGAGGTAATACTCGAGTATTACCTCTTTCTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026143.1-941s1c1
Sequence:CCGGGCAGGTGCTAACATGATGAATCTCGAGATTCATCATGTTAGCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1488s21c1
Sequence:CCGGATATTGATGTACGGCAGTTACCTCGAGGTAACTGCCGTACATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1608s21c1
Sequence:CCGGAGTTGCGGAATATCCGTTATGCTCGAGCATAACGGATATTCCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026143.2-2113s21c1
Sequence:CCGGCTTAACATGAAGTCCTAATATCTCGAGATATTAGGACTTCATGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1636s21c1
Sequence:CCGGTACAATCCTTGTGATACTTATCTCGAGATAAGTATCACAAGGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-773s21c1
Sequence:CCGGATGGATGATGGCCTAGTAAATCTCGAGATTTACTAGGCCATCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-508s21c1
Sequence:CCGGAGAAGATAAGGAGATCATTATCTCGAGATAATGATCTCCTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1879s21c1
Sequence:CCGGTAAATTGGAGCGTGGAGTAAACTCGAGTTTACTCCACGCTCCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1445s21c1
Sequence:CCGGATGTTAATGAACCAACTAAACCTCGAGGTTTAGTTGGTTCATTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026143
VALIDATED
FAR1 MISSION shRNA Lentiviral Transduction Particles
fatty acyl CoA reductase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026143.1-975s1c1
Sequence:CCGGGCAGAGCTAACGAGCATAGAACTCGAGTTCTATGCTCGTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026143.1-743s1c1
Sequence:CCGGCGTACATATACACCAAGGCATCTCGAGATGCCTTGGTGTATATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026143.1-897s1c1
Sequence:CCGGGTTTCAAGTTAGAACTGTGTACTCGAGTACACAGTTCTAACTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026143.1-985s1c1
Sequence:CCGGCGAGCATAGAAAGAGGTAATACTCGAGTATTACCTCTTTCTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026143.1-941s1c1
Sequence:CCGGGCAGGTGCTAACATGATGAATCTCGAGATTCATCATGTTAGCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1488s21c1
Sequence:CCGGATATTGATGTACGGCAGTTACCTCGAGGTAACTGCCGTACATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1608s21c1
Sequence:CCGGAGTTGCGGAATATCCGTTATGCTCGAGCATAACGGATATTCCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026143.2-2113s21c1
Sequence:CCGGCTTAACATGAAGTCCTAATATCTCGAGATATTAGGACTTCATGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1636s21c1
Sequence:CCGGTACAATCCTTGTGATACTTATCTCGAGATAAGTATCACAAGGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-773s21c1
Sequence:CCGGATGGATGATGGCCTAGTAAATCTCGAGATTTACTAGGCCATCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-508s21c1
Sequence:CCGGAGAAGATAAGGAGATCATTATCTCGAGATAATGATCTCCTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1879s21c1
Sequence:CCGGTAAATTGGAGCGTGGAGTAAACTCGAGTTTACTCCACGCTCCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026143.2-1445s21c1
Sequence:CCGGATGTTAATGAACCAACTAAACCTCGAGGTTTAGTTGGTTCATTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks