EMAIL THIS PAGE TO A FRIEND

FAR2

fatty acyl CoA reductase 2

56 Gene Product Result for
Synonyms: MLSTD1 SDR10E2
UniProtKB ID: Q96K12, Q9H0D5, Q9NVW8
Gene ID:
Human(55711) Summary: This gene belongs to the short chain dehydrogenase/reductase superfamily. It encodes a reductase enzyme involved in the first step of wax biosynthesis wherein fatty acids are converted to fatty alcohols. The encoded peroxisomal protein utilizes saturated fatty acids of 16 or 18 carbons as preferred substrates. Alternatively spliced transcript variants have been observed for this gene. Related pseudogenes have been identified on chromosomes 2, 14 and 22. [provided by RefSeq, Nov 2012]
Mouse(330450) fatty acyl CoA reductase 2
Rat(500368) fatty acyl CoA reductase 2
chicken(419043) fatty acyl CoA reductase 2
dog(477658) fatty acyl CoA reductase 2
cow(534380) fatty acyl CoA reductase 2
Horse(100069466) fatty acyl CoA reductase 2
domestic cat(101086070) fatty acyl CoA reductase 2
domestic guinea pig(100729160) fatty acyl CoA reductase 2
naked mole-rat(101701162) fatty acyl CoA reductase 2
sheep(101109003) fatty acyl CoA reductase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015884 Anti-FAR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300993 Anti-FAR2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV47392 Anti-MLSTD1 antibody produced in rabbit affinity isolated antibody horse, canine, mouse, human, rat, rabbit, zebrafish, guinea pig, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018099 Rosetta Predictions human pricing
XM_001074438 Rosetta Predictions rat pricing
XM_575726 Rosetta Predictions rat pricing
NM_178797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051148 predicted 1609
2 SASI_Hs01_00051149 predicted 1081
3 SASI_Hs01_00051150 predicted 1796
4 SASI_Hs01_00051151 predicted 441
5 SASI_Hs01_00051152 predicted 1154
6 SASI_Hs01_00051153 predicted 1004
7 SASI_Hs01_00051154 predicted 1172
8 SASI_Hs01_00051155 predicted 1752
9 SASI_Hs02_00351282 predicted 1156
10 SASI_Hs01_00051156 predicted 462
11 SASI_Hs01_00051157 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346242 predicted 1030
2 SASI_Rn02_00346243 predicted 1705
3 SASI_Rn02_00346244 predicted 1405
4 SASI_Rn02_00346245 predicted 970
5 SASI_Rn02_00346246 predicted 1040
6 SASI_Rn02_00346247 predicted 702
7 SASI_Rn02_00346248 predicted 1015
8 SASI_Rn02_00346249 predicted 263
9 SASI_Rn02_00346250 predicted 1428
10 SASI_Rn02_00346251 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404183 predicted 1032
2 SASI_Rn02_00404184 predicted 1164
3 SASI_Rn02_00404185 predicted 1710
4 SASI_Rn02_00404186 predicted 1403
5 SASI_Rn02_00404187 predicted 969
6 SASI_Rn02_00404188 predicted 1035
7 SASI_Rn02_00404189 predicted 701
8 SASI_Rn02_00404190 predicted 1019
9 SASI_Rn02_00404191 predicted 1431
10 SASI_Rn02_00404192 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072137 predicted 436
2 SASI_Mm01_00072139 predicted 1322
3 SASI_Mm01_00072140 predicted 949
4 SASI_Mm01_00072141 predicted 676
5 SASI_Mm01_00072142 predicted 1452
6 SASI_Mm01_00072143 predicted 1534
7 SASI_Mm01_00072144 predicted 995
8 SASI_Mm01_00072145 predicted 1171
9 SASI_Mm01_00072146 predicted 242
10 SASI_Mm02_00349402 predicted 1166
11 SASI_Mm01_00072138 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178797
FAR2 MISSION shRNA Bacterial Glycerol Stock
fatty acyl CoA reductase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-852s21c1
Sequence:CCGGTTCCCGGGTTGGGTTGATAATCTCGAGATTATCAACCCAACCCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1454s1c1
Sequence:CCGGGGTTAAGAAGTATCTACTAAACTCGAGTTTAGTAGATACTTCTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1168s21c1
Sequence:CCGGGCAATTTCACCACCCATTATTCTCGAGAATAATGGGTGGTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1064s21c1
Sequence:CCGGCAATCCCTGTAACTGGTATAACTCGAGTTATACCAGTTACAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1168s1c1
Sequence:CCGGGCAATTTCACCACCCATTATTCTCGAGAATAATGGGTGGTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-857s1c1
Sequence:CCGGGGGTTGGGTTGATAATCTAAACTCGAGTTTAGATTATCAACCCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1064s1c1
Sequence:CCGGCAATCCCTGTAACTGGTATAACTCGAGTTATACCAGTTACAGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178797.3-2804s21c1
Sequence:CCGGCACAATACACACCTGATATAACTCGAGTTATATCAGGTGTGTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1017s21c1
Sequence:CCGGCATAGGCCTAAATCAACATTACTCGAGTAATGTTGATTTAGGCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178797.2-2828s1c1
Sequence:CCGGCCCAAGACTTTCTTACATAATCTCGAGATTATGTAAGAAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.2-1602s1c1
Sequence:CCGGCGGAACGTCTGGTTCTTCATTCTCGAGAATGAAGAACCAGACGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178797
FAR2 MISSION shRNA shRNA Plasmid DNA
fatty acyl CoA reductase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-852s21c1
Sequence:CCGGTTCCCGGGTTGGGTTGATAATCTCGAGATTATCAACCCAACCCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1454s1c1
Sequence:CCGGGGTTAAGAAGTATCTACTAAACTCGAGTTTAGTAGATACTTCTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1168s21c1
Sequence:CCGGGCAATTTCACCACCCATTATTCTCGAGAATAATGGGTGGTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1064s21c1
Sequence:CCGGCAATCCCTGTAACTGGTATAACTCGAGTTATACCAGTTACAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1168s1c1
Sequence:CCGGGCAATTTCACCACCCATTATTCTCGAGAATAATGGGTGGTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-857s1c1
Sequence:CCGGGGGTTGGGTTGATAATCTAAACTCGAGTTTAGATTATCAACCCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1064s1c1
Sequence:CCGGCAATCCCTGTAACTGGTATAACTCGAGTTATACCAGTTACAGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178797.3-2804s21c1
Sequence:CCGGCACAATACACACCTGATATAACTCGAGTTATATCAGGTGTGTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1017s21c1
Sequence:CCGGCATAGGCCTAAATCAACATTACTCGAGTAATGTTGATTTAGGCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178797.2-2828s1c1
Sequence:CCGGCCCAAGACTTTCTTACATAATCTCGAGATTATGTAAGAAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.2-1602s1c1
Sequence:CCGGCGGAACGTCTGGTTCTTCATTCTCGAGAATGAAGAACCAGACGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178797
FAR2 MISSION shRNA Lentiviral Transduction Particles
fatty acyl CoA reductase 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-852s21c1
Sequence:CCGGTTCCCGGGTTGGGTTGATAATCTCGAGATTATCAACCCAACCCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1454s1c1
Sequence:CCGGGGTTAAGAAGTATCTACTAAACTCGAGTTTAGTAGATACTTCTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1168s21c1
Sequence:CCGGGCAATTTCACCACCCATTATTCTCGAGAATAATGGGTGGTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1064s21c1
Sequence:CCGGCAATCCCTGTAACTGGTATAACTCGAGTTATACCAGTTACAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1168s1c1
Sequence:CCGGGCAATTTCACCACCCATTATTCTCGAGAATAATGGGTGGTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-857s1c1
Sequence:CCGGGGGTTGGGTTGATAATCTAAACTCGAGTTTAGATTATCAACCCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.3-1064s1c1
Sequence:CCGGCAATCCCTGTAACTGGTATAACTCGAGTTATACCAGTTACAGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178797.3-2804s21c1
Sequence:CCGGCACAATACACACCTGATATAACTCGAGTTATATCAGGTGTGTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178797.3-1017s21c1
Sequence:CCGGCATAGGCCTAAATCAACATTACTCGAGTAATGTTGATTTAGGCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178797.2-2828s1c1
Sequence:CCGGCCCAAGACTTTCTTACATAATCTCGAGATTATGTAAGAAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178797.2-1602s1c1
Sequence:CCGGCGGAACGTCTGGTTCTTCATTCTCGAGAATGAAGAACCAGACGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018099
FAR2 MISSION shRNA Bacterial Glycerol Stock
fatty acyl CoA reductase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018099.3-2066s1c1
Sequence:CCGGCCTTGCGTATTAAACGTGAAACTCGAGTTTCACGTTTAATACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-1177s1c1
Sequence:CCGGCCACATTACATCTGGTAACATCTCGAGATGTTACCAGATGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-823s1c1
Sequence:CCGGCGATGCTATTATTGACGAGATCTCGAGATCTCGTCAATAATAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-494s1c1
Sequence:CCGGCATGAGAAGATCAGAGCTATTCTCGAGAATAGCTCTGATCTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-1672s1c1
Sequence:CCGGCCTCTTTAATACTGCCCTCTTCTCGAGAAGAGGGCAGTATTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018099
FAR2 MISSION shRNA shRNA Plasmid DNA
fatty acyl CoA reductase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018099.3-2066s1c1
Sequence:CCGGCCTTGCGTATTAAACGTGAAACTCGAGTTTCACGTTTAATACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-1177s1c1
Sequence:CCGGCCACATTACATCTGGTAACATCTCGAGATGTTACCAGATGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-823s1c1
Sequence:CCGGCGATGCTATTATTGACGAGATCTCGAGATCTCGTCAATAATAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-494s1c1
Sequence:CCGGCATGAGAAGATCAGAGCTATTCTCGAGAATAGCTCTGATCTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-1672s1c1
Sequence:CCGGCCTCTTTAATACTGCCCTCTTCTCGAGAAGAGGGCAGTATTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018099
FAR2 MISSION shRNA Lentiviral Transduction Particles
fatty acyl CoA reductase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018099.3-2066s1c1
Sequence:CCGGCCTTGCGTATTAAACGTGAAACTCGAGTTTCACGTTTAATACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-1177s1c1
Sequence:CCGGCCACATTACATCTGGTAACATCTCGAGATGTTACCAGATGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-823s1c1
Sequence:CCGGCGATGCTATTATTGACGAGATCTCGAGATCTCGTCAATAATAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-494s1c1
Sequence:CCGGCATGAGAAGATCAGAGCTATTCTCGAGAATAGCTCTGATCTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018099.3-1672s1c1
Sequence:CCGGCCTCTTTAATACTGCCCTCTTCTCGAGAAGAGGGCAGTATTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks