EMAIL THIS PAGE TO A FRIEND

FARP1

FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)

123 Gene Product Result for
Synonyms: CDEP PLEKHC2 PPP1R75
UniProtKB ID: Q9Y4F1, Q5JVI9, Q6IQ29
Gene ID:
Human(10160) Summary: This gene was originally isolated through subtractive hybridization due to its increased expression in differentiated chondrocytes versus dedifferentiated chondrocytes. The resulting protein contains a predicted ezrin-like domain, a Dbl homology domain, and a pleckstrin homology domain. It is believed to be a member of the band 4.1 superfamily whose members link the cytoskeleton to the cell membrane. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(223254) FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
Rat(306183) FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
chicken(418781) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
domestic cat(101098028) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
cow(531927) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Horse(100060841) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
dog(476970) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
sheep(101110152) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Domestic Rabbit(100352920) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
naked mole-rat(101717806) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
domestic guinea pig(100714154) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001715 Rosetta Predictions human pricing
NM_005766 Rosetta Predictions human pricing
NM_001107287 Rosetta Predictions rat pricing
NM_134082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124357 predicted 858
2 SASI_Hs01_00124359 predicted 694
3 SASI_Hs01_00124360 predicted 691
4 SASI_Hs01_00124361 predicted 926
5 SASI_Hs01_00124362 predicted 951
6 SASI_Hs01_00124363 predicted 925
7 SASI_Hs01_00124364 predicted 555
8 SASI_Hs01_00124365 predicted 625
9 SASI_Hs01_00124366 predicted 493
10 SASI_Hs02_00303910 predicted 954
11 SASI_Hs01_00124358 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034804 predicted 2895
2 SASI_Hs01_00034805 predicted 1934
3 SASI_Hs01_00034806 predicted 2076
4 SASI_Hs01_00034807 predicted 1696
5 SASI_Hs02_00340244 predicted 1229
6 SASI_Hs01_00034808 predicted 3441
7 SASI_Hs01_00034809 predicted 2748
8 SASI_Hs01_00034810 predicted 2008
9 SASI_Hs01_00034811 predicted 2348
10 SASI_Hs01_00034812 predicted 3328
11 SASI_Hs01_00034813 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227355 predicted 1033
2 SASI_Rn02_00227356 predicted 2415
3 SASI_Rn02_00227357 predicted 1869
4 SASI_Rn02_00227358 predicted 2896
5 SASI_Rn02_00227359 predicted 1562
6 SASI_Rn02_00227360 predicted 1687
7 SASI_Rn02_00227361 predicted 2999
8 SASI_Rn02_00227362 predicted 830
9 SASI_Rn02_00227363 predicted 2050
10 SASI_Rn02_00227364 predicted 3032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088471 predicted 1380
2 SASI_Mm01_00088472 predicted 2763
3 SASI_Mm02_00339307 predicted 1905
4 SASI_Mm01_00088473 predicted 1996
5 SASI_Mm01_00088474 predicted 923
6 SASI_Mm01_00088475 predicted 1325
7 SASI_Mm01_00088477 predicted 858
8 SASI_Mm01_00088478 predicted 1181
9 SASI_Mm01_00088479 predicted 997
10 SASI_Mm01_00088480 predicted 2107
11 SASI_Mm01_00088476 predicted 1075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001715
VALIDATED
FARP1 MISSION shRNA Bacterial Glycerol Stock
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001715.1-1028s1c1
Sequence:CCGGCCAGCCATAAATTAGACCAAACTCGAGTTTGGTCTAATTTATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-488s1c1
Sequence:CCGGAGGAGGCATTTGAAGTTCCAACTCGAGTTGGAACTTCAAATGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-695s1c1
Sequence:CCGGCAGTCACTGAAGAGCTTCTTACTCGAGTAAGAAGCTCTTCAGTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-584s1c1
Sequence:CCGGCCAAGCACCATTCACATCTAACTCGAGTTAGATGTGAATGGTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-635s1c1
Sequence:CCGGCTCATCTTACAGGCTCTATTTCTCGAGAAATAGAGCCTGTAAGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-561s21c1
Sequence:CCGGGGTACTGAGATGCTCCATGAACTCGAGTTCATGGAGCATCTCAGTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001715.2-774s21c1
Sequence:CCGGTGGCAATGGCCAGAGTTAAATCTCGAGATTTAACTCTGGCCATTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-662s21c1
Sequence:CCGGCAAACTGGGCTGGAAGTAGAACTCGAGTTCTACTTCCAGCCCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-584s21c1
Sequence:CCGGCCAAGCACCATTCACATCTAACTCGAGTTAGATGTGAATGGTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001715.2-402s21c1
Sequence:CCGGCAGTACCTTGGAACGTGGACACTCGAGTGTCCACGTTCCAAGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001715
VALIDATED
FARP1 MISSION shRNA shRNA Plasmid DNA
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001715.1-1028s1c1
Sequence:CCGGCCAGCCATAAATTAGACCAAACTCGAGTTTGGTCTAATTTATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-488s1c1
Sequence:CCGGAGGAGGCATTTGAAGTTCCAACTCGAGTTGGAACTTCAAATGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-695s1c1
Sequence:CCGGCAGTCACTGAAGAGCTTCTTACTCGAGTAAGAAGCTCTTCAGTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-584s1c1
Sequence:CCGGCCAAGCACCATTCACATCTAACTCGAGTTAGATGTGAATGGTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-635s1c1
Sequence:CCGGCTCATCTTACAGGCTCTATTTCTCGAGAAATAGAGCCTGTAAGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-561s21c1
Sequence:CCGGGGTACTGAGATGCTCCATGAACTCGAGTTCATGGAGCATCTCAGTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001715.2-774s21c1
Sequence:CCGGTGGCAATGGCCAGAGTTAAATCTCGAGATTTAACTCTGGCCATTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-662s21c1
Sequence:CCGGCAAACTGGGCTGGAAGTAGAACTCGAGTTCTACTTCCAGCCCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-584s21c1
Sequence:CCGGCCAAGCACCATTCACATCTAACTCGAGTTAGATGTGAATGGTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001715.2-402s21c1
Sequence:CCGGCAGTACCTTGGAACGTGGACACTCGAGTGTCCACGTTCCAAGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001715
VALIDATED
FARP1 MISSION shRNA Lentiviral Transduction Particles
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001715.1-1028s1c1
Sequence:CCGGCCAGCCATAAATTAGACCAAACTCGAGTTTGGTCTAATTTATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-488s1c1
Sequence:CCGGAGGAGGCATTTGAAGTTCCAACTCGAGTTGGAACTTCAAATGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-695s1c1
Sequence:CCGGCAGTCACTGAAGAGCTTCTTACTCGAGTAAGAAGCTCTTCAGTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-584s1c1
Sequence:CCGGCCAAGCACCATTCACATCTAACTCGAGTTAGATGTGAATGGTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001715.1-635s1c1
Sequence:CCGGCTCATCTTACAGGCTCTATTTCTCGAGAAATAGAGCCTGTAAGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-561s21c1
Sequence:CCGGGGTACTGAGATGCTCCATGAACTCGAGTTCATGGAGCATCTCAGTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001715.2-774s21c1
Sequence:CCGGTGGCAATGGCCAGAGTTAAATCTCGAGATTTAACTCTGGCCATTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-662s21c1
Sequence:CCGGCAAACTGGGCTGGAAGTAGAACTCGAGTTCTACTTCCAGCCCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001715.2-584s21c1
Sequence:CCGGCCAAGCACCATTCACATCTAACTCGAGTTAGATGTGAATGGTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001715.2-402s21c1
Sequence:CCGGCAGTACCTTGGAACGTGGACACTCGAGTGTCCACGTTCCAAGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134082
VALIDATED
FARP1 MISSION shRNA Bacterial Glycerol Stock
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-260s1c1
Sequence:CCGGCCGAAGCACGTCGTTGTTAAACTCGAGTTTAACAACGACGTGCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-832s1c1
Sequence:CCGGCCGAGACTTCTGCAAGTCTTTCTCGAGAAAGACTTGCAGAAGTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-1717s1c1
Sequence:CCGGGCACAAGTTCCATACCAATTTCTCGAGAAATTGGTATGGAACTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-3862s21c1
Sequence:CCGGTGCTGTTTCCCAAACGGATTTCTCGAGAAATCCGTTTGGGAAACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134082.3-2764s21c1
Sequence:CCGGACGGCATCTAATCAGTTTAAACTCGAGTTTAAACTGATTAGATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-1219s21c1
Sequence:CCGGCCTGACGTGAATAGCTCATACCTCGAGGTATGAGCTATTCACGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-696s21c1
Sequence:CCGGACCGAAGCACGTCGTTGTTAACTCGAGTTAACAACGACGTGCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-2443s21c1
Sequence:CCGGCACCGGCTCATGCACTATAAGCTCGAGCTTATAGTGCATGAGCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134082.3-4096s1c1
Sequence:CCGGGCTGTTTGTGATTCCTATTTACTCGAGTAAATAGGAATCACAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134082
VALIDATED
FARP1 MISSION shRNA shRNA Plasmid DNA
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-260s1c1
Sequence:CCGGCCGAAGCACGTCGTTGTTAAACTCGAGTTTAACAACGACGTGCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-832s1c1
Sequence:CCGGCCGAGACTTCTGCAAGTCTTTCTCGAGAAAGACTTGCAGAAGTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-1717s1c1
Sequence:CCGGGCACAAGTTCCATACCAATTTCTCGAGAAATTGGTATGGAACTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-3862s21c1
Sequence:CCGGTGCTGTTTCCCAAACGGATTTCTCGAGAAATCCGTTTGGGAAACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134082.3-2764s21c1
Sequence:CCGGACGGCATCTAATCAGTTTAAACTCGAGTTTAAACTGATTAGATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-1219s21c1
Sequence:CCGGCCTGACGTGAATAGCTCATACCTCGAGGTATGAGCTATTCACGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-696s21c1
Sequence:CCGGACCGAAGCACGTCGTTGTTAACTCGAGTTAACAACGACGTGCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-2443s21c1
Sequence:CCGGCACCGGCTCATGCACTATAAGCTCGAGCTTATAGTGCATGAGCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134082.3-4096s1c1
Sequence:CCGGGCTGTTTGTGATTCCTATTTACTCGAGTAAATAGGAATCACAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134082
VALIDATED
FARP1 MISSION shRNA Lentiviral Transduction Particles
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-260s1c1
Sequence:CCGGCCGAAGCACGTCGTTGTTAAACTCGAGTTTAACAACGACGTGCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-832s1c1
Sequence:CCGGCCGAGACTTCTGCAAGTCTTTCTCGAGAAAGACTTGCAGAAGTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134082.2-1717s1c1
Sequence:CCGGGCACAAGTTCCATACCAATTTCTCGAGAAATTGGTATGGAACTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-3862s21c1
Sequence:CCGGTGCTGTTTCCCAAACGGATTTCTCGAGAAATCCGTTTGGGAAACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134082.3-2764s21c1
Sequence:CCGGACGGCATCTAATCAGTTTAAACTCGAGTTTAAACTGATTAGATGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-1219s21c1
Sequence:CCGGCCTGACGTGAATAGCTCATACCTCGAGGTATGAGCTATTCACGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-696s21c1
Sequence:CCGGACCGAAGCACGTCGTTGTTAACTCGAGTTAACAACGACGTGCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134082.3-2443s21c1
Sequence:CCGGCACCGGCTCATGCACTATAAGCTCGAGCTTATAGTGCATGAGCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134082.3-4096s1c1
Sequence:CCGGGCTGTTTGTGATTCCTATTTACTCGAGTAAATAGGAATCACAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)