EMAIL THIS PAGE TO A FRIEND

FARP2

FERM, RhoGEF and pleckstrin domain protein 2

50 Gene Product Result for
Synonyms: FIR FRG PLEKHC3
UniProtKB ID: O94887, Q53QM5, Q8WU27, Q9UFE7
Gene ID:
Mouse(227377) FERM, RhoGEF and pleckstrin domain protein 2
Rat(316639) FERM, RhoGEF and pleckstrin domain protein 2
Zebrafish(567490) FERM, RhoGEF and pleckstrin domain protein 2
domestic cat(101096829) FERM, RhoGEF and pleckstrin domain protein 2
cow(100297153) FERM, RhoGEF and pleckstrin domain protein 2
Horse(100067721) FERM, RhoGEF and pleckstrin domain protein 2
dog(486205) FERM, RhoGEF and pleckstrin domain protein 2
chicken(424842) FERM, RhoGEF and pleckstrin domain protein 2
domestic guinea pig(100724219) FERM, RhoGEF and pleckstrin domain protein 2
naked mole-rat(101716035) FERM, RhoGEF and pleckstrin domain protein 2
sheep(101123259) FERM, RhoGEF and pleckstrin domain protein 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376193 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014808 Rosetta Predictions human pricing
NM_001108233 Rosetta Predictions rat pricing
NM_145519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231339 predicted 335
2 SASI_Hs01_00231340 predicted 408
3 SASI_Hs01_00231342 predicted 1982
4 SASI_Hs02_00346328 predicted 2062
5 SASI_Hs01_00231344 predicted 3100
6 SASI_Hs01_00231345 predicted 987
7 SASI_Hs01_00231346 predicted 758
8 SASI_Hs02_00346329 predicted 561
9 SASI_Hs01_00231347 predicted 2453
10 SASI_Hs01_00231348 predicted 1758
11 SASI_Hs01_00231341 predicted 1163
12 SASI_Hs01_00231343 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236634 predicted 1215
2 SASI_Rn02_00236635 predicted 1259
3 SASI_Rn02_00236636 predicted 336
4 SASI_Rn02_00236637 predicted 2400
5 SASI_Rn02_00236638 predicted 2554
6 SASI_Rn02_00236639 predicted 751
7 SASI_Rn02_00236640 predicted 3286
8 SASI_Rn02_00236641 predicted 2818
9 SASI_Rn02_00236642 predicted 1022
10 SASI_Rn02_00236643 predicted 2434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178565 predicted 324
2 SASI_Mm01_00178566 predicted 390
3 SASI_Mm01_00178567 predicted 813
4 SASI_Mm01_00178568 predicted 1990
5 SASI_Mm01_00178569 predicted 315
6 SASI_Mm01_00178570 predicted 291
7 SASI_Mm02_00340992 predicted 1233
8 SASI_Mm01_00178571 predicted 2539
9 SASI_Mm01_00178572 predicted 1754
10 SASI_Mm01_00178573 predicted 340
11 SASI_Mm01_00178574 predicted 984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376193
FARP2 MISSION shRNA Bacterial Glycerol Stock
FERM, RhoGEF and pleckstrin domain protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-351s1c1
Sequence:CCGGCCTGGTAGAATGTGACTACTTCTCGAGAAGTAGTCACATTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-621s1c1
Sequence:CCGGGCAGTCGGAAATAGGAGATTACTCGAGTAATCTCCTATTTCCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-2970s1c1
Sequence:CCGGCGTCTTTACCAACTTCTGTTTCTCGAGAAACAGAAGTTGGTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-3108s1c1
Sequence:CCGGCCAGTTCAAATCCCACGTCTACTCGAGTAGACGTGGGATTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-1767s1c1
Sequence:CCGGCCTCAAGGATTTAGAAGTTATCTCGAGATAACTTCTAAATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376193
FARP2 MISSION shRNA shRNA Plasmid DNA
FERM, RhoGEF and pleckstrin domain protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-351s1c1
Sequence:CCGGCCTGGTAGAATGTGACTACTTCTCGAGAAGTAGTCACATTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-621s1c1
Sequence:CCGGGCAGTCGGAAATAGGAGATTACTCGAGTAATCTCCTATTTCCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-2970s1c1
Sequence:CCGGCGTCTTTACCAACTTCTGTTTCTCGAGAAACAGAAGTTGGTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-3108s1c1
Sequence:CCGGCCAGTTCAAATCCCACGTCTACTCGAGTAGACGTGGGATTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-1767s1c1
Sequence:CCGGCCTCAAGGATTTAGAAGTTATCTCGAGATAACTTCTAAATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376193
FARP2 MISSION shRNA Lentiviral Transduction Particles
FERM, RhoGEF and pleckstrin domain protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-351s1c1
Sequence:CCGGCCTGGTAGAATGTGACTACTTCTCGAGAAGTAGTCACATTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-621s1c1
Sequence:CCGGGCAGTCGGAAATAGGAGATTACTCGAGTAATCTCCTATTTCCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-2970s1c1
Sequence:CCGGCGTCTTTACCAACTTCTGTTTCTCGAGAAACAGAAGTTGGTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-3108s1c1
Sequence:CCGGCCAGTTCAAATCCCACGTCTACTCGAGTAGACGTGGGATTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376193.1-1767s1c1
Sequence:CCGGCCTCAAGGATTTAGAAGTTATCTCGAGATAACTTCTAAATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145519
FARP2 MISSION shRNA Bacterial Glycerol Stock
FERM, RhoGEF and pleckstrin domain protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145519.1-3529s1c1
Sequence:CCGGGCCCTAAATACAGGTTGGATTCTCGAGAATCCAACCTGTATTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-602s1c1
Sequence:CCGGGCAGTCGGAAATCGGAGATTACTCGAGTAATCTCCGATTTCCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-3092s1c1
Sequence:CCGGCCAATTCAAATCTCACGTCTACTCGAGTAGACGTGAGATTTGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-1977s1c1
Sequence:CCGGCTCAGGAACATGCGTCAGTTACTCGAGTAACTGACGCATGTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-603s1c1
Sequence:CCGGCAGTCGGAAATCGGAGATTATCTCGAGATAATCTCCGATTTCCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145519
FARP2 MISSION shRNA shRNA Plasmid DNA
FERM, RhoGEF and pleckstrin domain protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145519.1-3529s1c1
Sequence:CCGGGCCCTAAATACAGGTTGGATTCTCGAGAATCCAACCTGTATTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-602s1c1
Sequence:CCGGGCAGTCGGAAATCGGAGATTACTCGAGTAATCTCCGATTTCCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-3092s1c1
Sequence:CCGGCCAATTCAAATCTCACGTCTACTCGAGTAGACGTGAGATTTGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-1977s1c1
Sequence:CCGGCTCAGGAACATGCGTCAGTTACTCGAGTAACTGACGCATGTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-603s1c1
Sequence:CCGGCAGTCGGAAATCGGAGATTATCTCGAGATAATCTCCGATTTCCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145519
FARP2 MISSION shRNA Lentiviral Transduction Particles
FERM, RhoGEF and pleckstrin domain protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145519.1-3529s1c1
Sequence:CCGGGCCCTAAATACAGGTTGGATTCTCGAGAATCCAACCTGTATTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-602s1c1
Sequence:CCGGGCAGTCGGAAATCGGAGATTACTCGAGTAATCTCCGATTTCCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-3092s1c1
Sequence:CCGGCCAATTCAAATCTCACGTCTACTCGAGTAGACGTGAGATTTGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-1977s1c1
Sequence:CCGGCTCAGGAACATGCGTCAGTTACTCGAGTAACTGACGCATGTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145519.1-603s1c1
Sequence:CCGGCAGTCGGAAATCGGAGATTATCTCGAGATAATCTCCGATTTCCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks