EMAIL THIS PAGE TO A FRIEND

FARS2

phenylalanyl-tRNA synthetase 2, mitochondrial

78 Gene Product Result for
Synonyms: COXPD14 FARS1 HSPC320 PheRS dJ520B18.2
Gene ID:
Human(10667) Summary: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. This gene encodes a phenylalanine-tRNA synthetase (PheRS) localized to the mitochondrion which consists of a single polypeptide chain, unlike the (alpha-beta)2 structure of the prokaryotic and eukaryotic cytoplasmic forms of PheRS. Structure analysis and catalytic properties indicate mitochondrial PheRSs may constitute a class of PheRS distinct from the enzymes found in prokaryotes and in the eukaryotic cytoplasm. [provided by RefSeq, Jul 2008]
Mouse(69955) phenylalanine-tRNA synthetase 2 (mitochondrial)
Rat(306879) phenylalanyl-tRNA synthetase 2, mitochondrial
Zebrafish(793097) phenylalanyl-tRNA synthetase 2, mitochondrial
dog(488204) phenylalanyl-tRNA synthetase 2, mitochondrial
Horse(100050751) phenylalanyl-tRNA synthetase 2, mitochondrial
cow(505390) phenylalanyl-tRNA synthetase 2, mitochondrial
chicken(428482) phenylalanyl-tRNA synthetase 2, mitochondrial
sheep(101120705) phenylalanyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101717977) phenylalanyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100723260) phenylalanyl-tRNA synthetase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006567 Rosetta Predictions human pricing
NM_001013139 Rosetta Predictions rat pricing
NM_001039189 Rosetta Predictions mouse pricing
NM_024274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341839 predicted 347
2 SASI_Hs02_00341840 predicted 1406
3 SASI_Hs02_00341841 predicted 681
4 SASI_Hs02_00341842 predicted 1437
5 SASI_Hs01_00199660 predicted 776
6 SASI_Hs02_00341843 predicted 652
7 SASI_Hs01_00199662 predicted 377
8 SASI_Hs02_00341844 predicted 1562
9 SASI_Hs02_00341845 predicted 1569
10 SASI_Hs02_00341846 predicted 513
11 SASI_Hs01_00199654 predicted 1089
12 SASI_Hs01_00199655 predicted 961
13 SASI_Hs01_00199656 predicted 902
14 SASI_Hs01_00199657 predicted 794
15 SASI_Hs01_00199658 predicted 1210
16 SASI_Hs01_00199659 predicted 1144
17 SASI_Hs01_00199661 predicted 1216
18 SASI_Hs01_00199663 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068406 predicted 623
2 SASI_Rn01_00068407 predicted 1213
3 SASI_Rn01_00068408 predicted 352
4 SASI_Rn01_00068409 predicted 791
5 SASI_Rn01_00068410 predicted 1064
6 SASI_Rn02_00200863 predicted 898
7 SASI_Rn01_00068411 predicted 1489
8 SASI_Rn02_00200864 predicted 1328
9 SASI_Rn01_00068413 predicted 829
10 SASI_Rn01_00068414 predicted 654
11 SASI_Rn01_00068412 predicted 245
12 SASI_Rn01_00068415 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052772 predicted 1110
2 SASI_Mm01_00052773 predicted 1063
3 SASI_Mm01_00052774 predicted 907
4 SASI_Mm01_00052775 predicted 929
5 SASI_Mm01_00052776 predicted 941
6 SASI_Mm01_00052777 predicted 1006
7 SASI_Mm01_00052778 predicted 897
8 SASI_Mm01_00052779 predicted 1221
9 SASI_Mm01_00052780 predicted 1098
10 SASI_Mm02_00289934 predicted 907
11 SASI_Mm01_00052781 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161570 predicted 1738
2 SASI_Mm01_00161571 predicted 1694
3 SASI_Mm01_00161572 predicted 1543
4 SASI_Mm01_00161573 predicted 1562
5 SASI_Mm01_00161574 predicted 1566
6 SASI_Mm01_00161575 predicted 1633
7 SASI_Mm01_00161576 predicted 1522
8 SASI_Mm01_00161577 predicted 1856
9 SASI_Mm01_00161578 predicted 1735
10 SASI_Mm02_00327694 predicted 1543
11 SASI_Mm01_00161579 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006567
VALIDATED
FARS2 MISSION shRNA Bacterial Glycerol Stock
phenylalanyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-1127s1c1
Sequence:CCGGCCTCTGAGAATTACGCAGAAACTCGAGTTTCTGCGTAATTCTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-715s1c1
Sequence:CCGGGCCGTGAAGCTTGTAGAGTTTCTCGAGAAACTCTACAAGCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-618s1c1
Sequence:CCGGGCATGAGTTATTTGCTGGTATCTCGAGATACCAGCAAATAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-1064s1c1
Sequence:CCGGAGGTGAAGTTTCAGCCTCTTACTCGAGTAAGAGGCTGAAACTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006567.1-295s1c1
Sequence:CCGGGAGCACTTCTACAAGCAGTATCTCGAGATACTGCTTGTAGAAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006567.3-941s21c1
Sequence:CCGGGAGTTATTTGCTGGTATAAAGCTCGAGCTTTATACCAGCAAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-1411s21c1
Sequence:CCGGTCCGGCTGTGATCAATGATATCTCGAGATATCATTGATCACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-1212s21c1
Sequence:GTACCGGTGGAACAACAACTGGTCAATTCTCGAGAATTGACCAGTTGTTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006567.3-882s21c1
Sequence:CCGGACTCCCAGCACTACCCTATTTCTCGAGAAATAGGGTAGTGCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-992s21c1
Sequence:CCGGAGTTCTCGCTCTGCGCATAAACTCGAGTTTATGCGCAGAGCGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006567
VALIDATED
FARS2 MISSION shRNA shRNA Plasmid DNA
phenylalanyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-1127s1c1
Sequence:CCGGCCTCTGAGAATTACGCAGAAACTCGAGTTTCTGCGTAATTCTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-715s1c1
Sequence:CCGGGCCGTGAAGCTTGTAGAGTTTCTCGAGAAACTCTACAAGCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-618s1c1
Sequence:CCGGGCATGAGTTATTTGCTGGTATCTCGAGATACCAGCAAATAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-1064s1c1
Sequence:CCGGAGGTGAAGTTTCAGCCTCTTACTCGAGTAAGAGGCTGAAACTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006567.1-295s1c1
Sequence:CCGGGAGCACTTCTACAAGCAGTATCTCGAGATACTGCTTGTAGAAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006567.3-941s21c1
Sequence:CCGGGAGTTATTTGCTGGTATAAAGCTCGAGCTTTATACCAGCAAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-1411s21c1
Sequence:CCGGTCCGGCTGTGATCAATGATATCTCGAGATATCATTGATCACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-1212s21c1
Sequence:GTACCGGTGGAACAACAACTGGTCAATTCTCGAGAATTGACCAGTTGTTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006567.3-882s21c1
Sequence:CCGGACTCCCAGCACTACCCTATTTCTCGAGAAATAGGGTAGTGCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-992s21c1
Sequence:CCGGAGTTCTCGCTCTGCGCATAAACTCGAGTTTATGCGCAGAGCGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006567
VALIDATED
FARS2 MISSION shRNA Lentiviral Transduction Particles
phenylalanyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-1127s1c1
Sequence:CCGGCCTCTGAGAATTACGCAGAAACTCGAGTTTCTGCGTAATTCTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-715s1c1
Sequence:CCGGGCCGTGAAGCTTGTAGAGTTTCTCGAGAAACTCTACAAGCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-618s1c1
Sequence:CCGGGCATGAGTTATTTGCTGGTATCTCGAGATACCAGCAAATAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006567.1-1064s1c1
Sequence:CCGGAGGTGAAGTTTCAGCCTCTTACTCGAGTAAGAGGCTGAAACTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006567.1-295s1c1
Sequence:CCGGGAGCACTTCTACAAGCAGTATCTCGAGATACTGCTTGTAGAAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006567.3-941s21c1
Sequence:CCGGGAGTTATTTGCTGGTATAAAGCTCGAGCTTTATACCAGCAAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-1411s21c1
Sequence:CCGGTCCGGCTGTGATCAATGATATCTCGAGATATCATTGATCACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-1212s21c1
Sequence:GTACCGGTGGAACAACAACTGGTCAATTCTCGAGAATTGACCAGTTGTTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006567.3-882s21c1
Sequence:CCGGACTCCCAGCACTACCCTATTTCTCGAGAAATAGGGTAGTGCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006567.3-992s21c1
Sequence:CCGGAGTTCTCGCTCTGCGCATAAACTCGAGTTTATGCGCAGAGCGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024274
FARS2 MISSION shRNA Bacterial Glycerol Stock
phenylalanyl-tRNA synthetase 2, mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-526s1c1
Sequence:CCGGGAACTTTGATAGCCTGCTAATCTCGAGATTAGCAGGCTATCAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-865s1c1
Sequence:CCGGGCTTGTGGAGTTCGACCTTAACTCGAGTTAAGGTCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-866s21c4
Sequence:CCGGCACCCTCTGTGGCTGATTAAGCTCGAGCTTAATCAGCCACAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1226s21c1
Sequence:CCGGGAGTTATTTGCTGGCGTAAAGCTCGAGCTTTACGCCAGCAAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-1239s1c2
Sequence:CCGGCCGTGTTCAATGACATTTCATCTCGAGATGAAATGTCATTGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-697s1c2
Sequence:CCGGCCAGATTGATTGCCAGCACTACTCGAGTAGTGCTGGCAATCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024274.1-1512s1c2
Sequence:CCGGGCAGTGGCAGTCCACAGGCCACTCGAGTGGCCTGTGGACTGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1103s21c1
Sequence:CCGGTTGCTGCATGCGGGACTTAATCTCGAGATTAAGTCCCGCATGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-925s21c1
Sequence:CCGGGCGATCCAGGACACCTCTATTCTCGAGAATAGAGGTGTCCTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1131s21c1
Sequence:CCGGTTGTGGTAGGTGACGTGTATCCTCGAGGATACACGTCACCTACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024274
FARS2 MISSION shRNA shRNA Plasmid DNA
phenylalanyl-tRNA synthetase 2, mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-526s1c1
Sequence:CCGGGAACTTTGATAGCCTGCTAATCTCGAGATTAGCAGGCTATCAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-865s1c1
Sequence:CCGGGCTTGTGGAGTTCGACCTTAACTCGAGTTAAGGTCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-866s21c4
Sequence:CCGGCACCCTCTGTGGCTGATTAAGCTCGAGCTTAATCAGCCACAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1226s21c1
Sequence:CCGGGAGTTATTTGCTGGCGTAAAGCTCGAGCTTTACGCCAGCAAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-1239s1c2
Sequence:CCGGCCGTGTTCAATGACATTTCATCTCGAGATGAAATGTCATTGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-697s1c2
Sequence:CCGGCCAGATTGATTGCCAGCACTACTCGAGTAGTGCTGGCAATCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024274.1-1512s1c2
Sequence:CCGGGCAGTGGCAGTCCACAGGCCACTCGAGTGGCCTGTGGACTGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1103s21c1
Sequence:CCGGTTGCTGCATGCGGGACTTAATCTCGAGATTAAGTCCCGCATGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-925s21c1
Sequence:CCGGGCGATCCAGGACACCTCTATTCTCGAGAATAGAGGTGTCCTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1131s21c1
Sequence:CCGGTTGTGGTAGGTGACGTGTATCCTCGAGGATACACGTCACCTACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024274
FARS2 MISSION shRNA Lentiviral Transduction Particles
phenylalanyl-tRNA synthetase 2, mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-526s1c1
Sequence:CCGGGAACTTTGATAGCCTGCTAATCTCGAGATTAGCAGGCTATCAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-865s1c1
Sequence:CCGGGCTTGTGGAGTTCGACCTTAACTCGAGTTAAGGTCGAACTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-866s21c4
Sequence:CCGGCACCCTCTGTGGCTGATTAAGCTCGAGCTTAATCAGCCACAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1226s21c1
Sequence:CCGGGAGTTATTTGCTGGCGTAAAGCTCGAGCTTTACGCCAGCAAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-1239s1c2
Sequence:CCGGCCGTGTTCAATGACATTTCATCTCGAGATGAAATGTCATTGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024274.1-697s1c2
Sequence:CCGGCCAGATTGATTGCCAGCACTACTCGAGTAGTGCTGGCAATCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024274.1-1512s1c2
Sequence:CCGGGCAGTGGCAGTCCACAGGCCACTCGAGTGGCCTGTGGACTGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1103s21c1
Sequence:CCGGTTGCTGCATGCGGGACTTAATCTCGAGATTAAGTCCCGCATGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-925s21c1
Sequence:CCGGGCGATCCAGGACACCTCTATTCTCGAGAATAGAGGTGTCCTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024274.2-1131s21c1
Sequence:CCGGTTGTGGTAGGTGACGTGTATCCTCGAGGATACACGTCACCTACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks