EMAIL THIS PAGE TO A FRIEND

FARSA

phenylalanyl-tRNA synthetase, alpha subunit

46 Gene Product Result for
Synonyms: CML33 FARSL FARSLA FRSA PheHA
UniProtKB ID: Q9Y285, Q9NSD8, Q9Y4W8
Gene ID:
Human(2193) Summary: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. This gene encodes a product which is similar to the catalytic subunit of prokaryotic and Saccharomyces cerevisiae phenylalanyl-tRNA synthetases (PheRS). This gene product has been shown to be expressed in a tumor-selective and cell cycle stage- and differentiation-dependent manner, the first member of the tRNA synthetase gene family shown to exhibit this type of regulated expression [provided by RefSeq, Jul 2008]
Mouse(66590) phenylalanyl-tRNA synthetase, alpha subunit
Rat(288917) phenylalanyl-tRNA synthetase, alpha subunit
domestic guinea pig(100714661) phenylalanyl-tRNA synthetase, alpha subunit
naked mole-rat(101718704) phenylalanyl-tRNA synthetase, alpha subunit
sheep(101105073) phenylalanyl-tRNA synthetase, alpha subunit
Zebrafish(692329) phenylalanyl-tRNA synthetase, alpha subunit
dog(476695) phenylalanyl-tRNA synthetase, alpha subunit
domestic cat(101087135) phenylalanyl-tRNA synthetase, alpha subunit
cow(522024) phenylalanyl-tRNA synthetase, alpha subunit
Horse(100063275) phenylalanyl-tRNA synthetase, alpha subunit
chicken(100859604) phenylalanyl-tRNA synthetase, alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026781 MISSION® esiRNA esiRNA human FARSA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004461 Rosetta Predictions human pricing
NM_001024237 Rosetta Predictions rat pricing
NM_025648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080605 predicted 659
2 SASI_Hs01_00080606 predicted 1296
3 SASI_Hs01_00080607 predicted 1393
4 SASI_Hs01_00080608 predicted 628
5 SASI_Hs01_00080609 predicted 252
6 SASI_Hs01_00080610 predicted 1256
7 SASI_Hs01_00080611 predicted 1171
8 SASI_Hs01_00080612 predicted 263
9 SASI_Hs01_00080614 predicted 872
10 SASI_Hs02_00337655 predicted 1188
11 SASI_Hs01_00080613 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202378 predicted 398
2 SASI_Rn01_00051594 predicted 1037
3 SASI_Rn01_00051595 predicted 923
4 SASI_Rn01_00051596 predicted 210
5 SASI_Rn01_00051599 predicted 1397
6 SASI_Rn01_00051600 predicted 1412
7 SASI_Rn01_00051601 predicted 709
8 SASI_Rn01_00051602 predicted 1198
9 SASI_Rn02_00202379 predicted 881
10 SASI_Rn01_00051603 predicted 637
11 SASI_Rn01_00051597 predicted 1049
12 SASI_Rn01_00051598 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328755 predicted 1448
2 SASI_Mm02_00328756 predicted 1074
3 SASI_Mm02_00328757 predicted 245
4 SASI_Mm02_00328758 predicted 1091
5 SASI_Mm02_00328759 predicted 1242
6 SASI_Mm02_00328760 predicted 627
7 SASI_Mm02_00328761 predicted 816
8 SASI_Mm02_00328762 predicted 745
9 SASI_Mm02_00328763 predicted 914
10 SASI_Mm02_00328764 predicted 1159
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004461
FARSA MISSION shRNA Bacterial Glycerol Stock
phenylalanyl-tRNA synthetase, alpha subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004461.2-1651s21c1
Sequence:CCGGTTGTATTTATGAGGCCTCTGTCTCGAGACAGAGGCCTCATAAATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004461.2-1099s21c1
Sequence:CCGGTTCTCCATCGACCGCGTATTCCTCGAGGAATACGCGGTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004461.2-1584s21c1
Sequence:CCGGACTCTAGGACAGGTCATCCTCCTCGAGGAGGATGACCTGTCCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-331s1c1
Sequence:CCGGGCCATGTCCAACAAGTGGATTCTCGAGAATCCACTTGTTGGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-539s1c1
Sequence:CCGGGCAAAGGCAGTGCCTTTAGTACTCGAGTACTAAAGGCACTGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-835s1c1
Sequence:CCGGGACACCTTCTTCCTTCGAGATCTCGAGATCTCGAAGGAAGAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-1398s1c1
Sequence:CCGGGCGCCCAACGATGATCAAATACTCGAGTATTTGATCATCGTTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-1357s1c1
Sequence:CCGGCCCGAGAACGTGTCGGTCATTCTCGAGAATGACCGACACGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004461
FARSA MISSION shRNA shRNA Plasmid DNA
phenylalanyl-tRNA synthetase, alpha subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004461.2-1651s21c1
Sequence:CCGGTTGTATTTATGAGGCCTCTGTCTCGAGACAGAGGCCTCATAAATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004461.2-1099s21c1
Sequence:CCGGTTCTCCATCGACCGCGTATTCCTCGAGGAATACGCGGTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004461.2-1584s21c1
Sequence:CCGGACTCTAGGACAGGTCATCCTCCTCGAGGAGGATGACCTGTCCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-331s1c1
Sequence:CCGGGCCATGTCCAACAAGTGGATTCTCGAGAATCCACTTGTTGGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-539s1c1
Sequence:CCGGGCAAAGGCAGTGCCTTTAGTACTCGAGTACTAAAGGCACTGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-835s1c1
Sequence:CCGGGACACCTTCTTCCTTCGAGATCTCGAGATCTCGAAGGAAGAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-1398s1c1
Sequence:CCGGGCGCCCAACGATGATCAAATACTCGAGTATTTGATCATCGTTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-1357s1c1
Sequence:CCGGCCCGAGAACGTGTCGGTCATTCTCGAGAATGACCGACACGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004461
FARSA MISSION shRNA Lentiviral Transduction Particles
phenylalanyl-tRNA synthetase, alpha subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004461.2-1651s21c1
Sequence:CCGGTTGTATTTATGAGGCCTCTGTCTCGAGACAGAGGCCTCATAAATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004461.2-1099s21c1
Sequence:CCGGTTCTCCATCGACCGCGTATTCCTCGAGGAATACGCGGTCGATGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004461.2-1584s21c1
Sequence:CCGGACTCTAGGACAGGTCATCCTCCTCGAGGAGGATGACCTGTCCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-331s1c1
Sequence:CCGGGCCATGTCCAACAAGTGGATTCTCGAGAATCCACTTGTTGGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-539s1c1
Sequence:CCGGGCAAAGGCAGTGCCTTTAGTACTCGAGTACTAAAGGCACTGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-835s1c1
Sequence:CCGGGACACCTTCTTCCTTCGAGATCTCGAGATCTCGAAGGAAGAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-1398s1c1
Sequence:CCGGGCGCCCAACGATGATCAAATACTCGAGTATTTGATCATCGTTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004461.1-1357s1c1
Sequence:CCGGCCCGAGAACGTGTCGGTCATTCTCGAGAATGACCGACACGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025648
VALIDATED
FARSA MISSION shRNA Bacterial Glycerol Stock
phenylalanyl-tRNA synthetase, alpha subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-542s21c1
Sequence:CCGGCTGACGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-589s21c1
Sequence:CCGGCTTCAGCACAAGCGTGTCTAACTCGAGTTAGACACGCTTGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-751s21c1
Sequence:CCGGCCGACAAATCTTCTTGGAGATCTCGAGATCTCCAAGAAGATTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-739s21c1
Sequence:CCGGCCGCTCTCAGTTCCGACAAATCTCGAGATTTGTCGGAACTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-1620s21c1
Sequence:CCGGTTGGCAGTGACCTACTATTTACTCGAGTAAATAGTAGGTCACTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025648.1-2896s1c1
Sequence:CCGGCCTGACTAGATAGTTCCTGAACTCGAGTTCAGGAACTATCTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-713s1c1
Sequence:CCGGCCGACAAATCTTCTTGGAGATCTCGAGATCTCCAAGAAGATTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-551s1c1
Sequence:CCGGCTTCAGCACAAGCGTGTCTAACTCGAGTTAGACACGCTTGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-504s1c1
Sequence:CCGGCTGACGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-701s1c1
Sequence:CCGGCCGCTCTCAGTTCCGACAAATCTCGAGATTTGTCGGAACTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025648
VALIDATED
FARSA MISSION shRNA shRNA Plasmid DNA
phenylalanyl-tRNA synthetase, alpha subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-542s21c1
Sequence:CCGGCTGACGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-589s21c1
Sequence:CCGGCTTCAGCACAAGCGTGTCTAACTCGAGTTAGACACGCTTGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-751s21c1
Sequence:CCGGCCGACAAATCTTCTTGGAGATCTCGAGATCTCCAAGAAGATTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-739s21c1
Sequence:CCGGCCGCTCTCAGTTCCGACAAATCTCGAGATTTGTCGGAACTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-1620s21c1
Sequence:CCGGTTGGCAGTGACCTACTATTTACTCGAGTAAATAGTAGGTCACTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025648.1-2896s1c1
Sequence:CCGGCCTGACTAGATAGTTCCTGAACTCGAGTTCAGGAACTATCTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-713s1c1
Sequence:CCGGCCGACAAATCTTCTTGGAGATCTCGAGATCTCCAAGAAGATTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-551s1c1
Sequence:CCGGCTTCAGCACAAGCGTGTCTAACTCGAGTTAGACACGCTTGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-504s1c1
Sequence:CCGGCTGACGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-701s1c1
Sequence:CCGGCCGCTCTCAGTTCCGACAAATCTCGAGATTTGTCGGAACTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025648
VALIDATED
FARSA MISSION shRNA Lentiviral Transduction Particles
phenylalanyl-tRNA synthetase, alpha subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-542s21c1
Sequence:CCGGCTGACGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-589s21c1
Sequence:CCGGCTTCAGCACAAGCGTGTCTAACTCGAGTTAGACACGCTTGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-751s21c1
Sequence:CCGGCCGACAAATCTTCTTGGAGATCTCGAGATCTCCAAGAAGATTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-739s21c1
Sequence:CCGGCCGCTCTCAGTTCCGACAAATCTCGAGATTTGTCGGAACTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025648.3-1620s21c1
Sequence:CCGGTTGGCAGTGACCTACTATTTACTCGAGTAAATAGTAGGTCACTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025648.1-2896s1c1
Sequence:CCGGCCTGACTAGATAGTTCCTGAACTCGAGTTCAGGAACTATCTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-713s1c1
Sequence:CCGGCCGACAAATCTTCTTGGAGATCTCGAGATCTCCAAGAAGATTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-551s1c1
Sequence:CCGGCTTCAGCACAAGCGTGTCTAACTCGAGTTAGACACGCTTGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-504s1c1
Sequence:CCGGCTGACGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025648.1-701s1c1
Sequence:CCGGCCGCTCTCAGTTCCGACAAATCTCGAGATTTGTCGGAACTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks