EMAIL THIS PAGE TO A FRIEND

FARSB

phenylalanyl-tRNA synthetase, beta subunit

59 Gene Product Result for
Synonyms: FARSLB FRSB PheHB PheRS
UniProtKB ID: Q9NSD9, O95708, Q4ZFX1, Q57ZJ5, Q9NZZ6
Gene ID:
Human(10056) Summary: This gene encodes a highly conserved enzyme that belongs to the aminoacyl-tRNA synthetase class IIc subfamily. This enzyme comprises the regulatory beta subunits that form a tetramer with two catalytic alpha subunits. In the presence of ATP, this tetramer is responsible for attaching L-phenylalanine to the terminal adenosine of the appropriate tRNA. A pseudogene located on chromosome 10 has been identified. [provided by RefSeq, Jul 2008]
Mouse(23874) phenylalanyl-tRNA synthetase, beta subunit
Rat(301544) phenylalanyl-tRNA synthetase, beta subunit
Zebrafish(493608) phenylalanyl-tRNA synthetase, beta subunit
cow(788792) phenylalanyl-tRNA synthetase, beta subunit
cow(509118) phenylalanyl-tRNA synthetase, beta subunit pseudogene
Horse(100056565) phenylalanyl-tRNA synthetase, beta subunit
domestic cat(101081747) phenylalanyl-tRNA synthetase, beta subunit
dog(478926) phenylalanyl-tRNA synthetase, beta subunit
chicken(424812) phenylalanyl-tRNA synthetase, beta subunit
Goat(100861378) phenylalanyl-tRNA synthetase, beta subunit
sheep(101119961) phenylalanyl-tRNA synthetase, beta subunit
naked mole-rat(101702505) phenylalanyl-tRNA synthetase, beta subunit
domestic guinea pig(100730983) phenylalanyl-tRNA synthetase, beta subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005687 Rosetta Predictions human pricing
NM_001004252 Rosetta Predictions rat pricing
NM_011811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216634 predicted 296
2 SASI_Hs01_00216635 predicted 599
3 SASI_Hs01_00216636 predicted 1222
4 SASI_Hs01_00216637 predicted 1191
5 SASI_Hs01_00216638 predicted 1315
6 SASI_Hs01_00216640 predicted 1285
7 SASI_Hs01_00216641 predicted 1185
8 SASI_Hs02_00340081 predicted 1299
9 SASI_Hs02_00340082 predicted 1014
10 SASI_Hs02_00340083 predicted 630
11 SASI_Hs01_00216633 predicted 673
12 SASI_Hs01_00216639 predicted 606
13 SASI_Hs01_00216642 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056059 predicted 1110
2 SASI_Rn01_00056060 predicted 1163
3 SASI_Rn01_00056061 predicted 348
4 SASI_Rn01_00056062 predicted 1456
5 SASI_Rn01_00056063 predicted 1263
6 SASI_Rn02_00198270 predicted 549
7 SASI_Rn01_00056064 predicted 1034
8 SASI_Rn01_00056065 predicted 1859
9 SASI_Rn01_00056067 predicted 1053
10 SASI_Rn02_00198271 predicted 217
11 SASI_Rn01_00056066 predicted 1130
12 SASI_Rn01_00056068 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059404 predicted 1455
2 SASI_Mm01_00059405 predicted 584
3 SASI_Mm01_00059406 predicted 1107
4 SASI_Mm01_00059408 predicted 1026
5 SASI_Mm01_00059409 predicted 1114
6 SASI_Mm01_00059410 predicted 1162
7 SASI_Mm01_00059411 predicted 1870
8 SASI_Mm01_00059412 predicted 268
9 SASI_Mm01_00059413 predicted 404
10 SASI_Mm02_00321500 predicted 390
11 SASI_Mm01_00059407 predicted 1160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005687
VALIDATED
FARSB MISSION shRNA Bacterial Glycerol Stock
phenylalanyl-tRNA synthetase, beta subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-520s1c1
Sequence:CCGGCCCATTTACTTATACTGCAAACTCGAGTTTGCAGTATAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-63s1c1
Sequence:CCGGGCACCTACACTGACGAAGAATCTCGAGATTCTTCGTCAGTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-1094s1c1
Sequence:CCGGGCATGTGATATTGTAGAAGATCTCGAGATCTTCTACAATATCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-674s1c1
Sequence:CCGGCCAGTTATCTATGATAGCAATCTCGAGATTGCTATCATAGATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-1555s1c1
Sequence:CCGGGCTGGACAGAATTATGCAGTTCTCGAGAACTGCATAATTCTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005687.3-1577s21c1
Sequence:CCGGGCTGGACAGAATTATGCAGTTCTCGAGAACTGCATAATTCTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-85s21c1
Sequence:CCGGGCACCTACACTGACGAAGAATCTCGAGATTCTTCGTCAGTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-1116s21c1
Sequence:CCGGGCATGTGATATTGTAGAAGATCTCGAGATCTTCTACAATATCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005687.3-1950s21c1
Sequence:CCGGCCATCCTTTCCCTGCATATTACTCGAGTAATATGCAGGGAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-1139s21c1
Sequence:CCGGAGCTATTGCTTATGGATATAACTCGAGTTATATCCATAAGCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005687
VALIDATED
FARSB MISSION shRNA shRNA Plasmid DNA
phenylalanyl-tRNA synthetase, beta subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-520s1c1
Sequence:CCGGCCCATTTACTTATACTGCAAACTCGAGTTTGCAGTATAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-63s1c1
Sequence:CCGGGCACCTACACTGACGAAGAATCTCGAGATTCTTCGTCAGTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-1094s1c1
Sequence:CCGGGCATGTGATATTGTAGAAGATCTCGAGATCTTCTACAATATCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-674s1c1
Sequence:CCGGCCAGTTATCTATGATAGCAATCTCGAGATTGCTATCATAGATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-1555s1c1
Sequence:CCGGGCTGGACAGAATTATGCAGTTCTCGAGAACTGCATAATTCTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005687.3-1577s21c1
Sequence:CCGGGCTGGACAGAATTATGCAGTTCTCGAGAACTGCATAATTCTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-85s21c1
Sequence:CCGGGCACCTACACTGACGAAGAATCTCGAGATTCTTCGTCAGTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-1116s21c1
Sequence:CCGGGCATGTGATATTGTAGAAGATCTCGAGATCTTCTACAATATCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005687.3-1950s21c1
Sequence:CCGGCCATCCTTTCCCTGCATATTACTCGAGTAATATGCAGGGAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-1139s21c1
Sequence:CCGGAGCTATTGCTTATGGATATAACTCGAGTTATATCCATAAGCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005687
VALIDATED
FARSB MISSION shRNA Lentiviral Transduction Particles
phenylalanyl-tRNA synthetase, beta subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-520s1c1
Sequence:CCGGCCCATTTACTTATACTGCAAACTCGAGTTTGCAGTATAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-63s1c1
Sequence:CCGGGCACCTACACTGACGAAGAATCTCGAGATTCTTCGTCAGTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-1094s1c1
Sequence:CCGGGCATGTGATATTGTAGAAGATCTCGAGATCTTCTACAATATCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-674s1c1
Sequence:CCGGCCAGTTATCTATGATAGCAATCTCGAGATTGCTATCATAGATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005687.2-1555s1c1
Sequence:CCGGGCTGGACAGAATTATGCAGTTCTCGAGAACTGCATAATTCTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005687.3-1577s21c1
Sequence:CCGGGCTGGACAGAATTATGCAGTTCTCGAGAACTGCATAATTCTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-85s21c1
Sequence:CCGGGCACCTACACTGACGAAGAATCTCGAGATTCTTCGTCAGTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-1116s21c1
Sequence:CCGGGCATGTGATATTGTAGAAGATCTCGAGATCTTCTACAATATCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005687.3-1950s21c1
Sequence:CCGGCCATCCTTTCCCTGCATATTACTCGAGTAATATGCAGGGAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005687.3-1139s21c1
Sequence:CCGGAGCTATTGCTTATGGATATAACTCGAGTTATATCCATAAGCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011811
FARSB MISSION shRNA Bacterial Glycerol Stock
phenylalanyl-tRNA synthetase, beta subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011811.2-1924s1c1
Sequence:CCGGGCTGGTGTGTATCTGCATGTACTCGAGTACATGCAGATACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-710s1c1
Sequence:CCGGCCGATTATAAATGGGAATCATCTCGAGATGATTCCCATTTATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-515s1c1
Sequence:CCGGCCATTTACTTACACCGCGAAACTCGAGTTTCGCGGTGTAAGTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-514s1c1
Sequence:CCGGCCCATTTACTTACACCGCGAACTCGAGTTCGCGGTGTAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-1038s1c1
Sequence:CCGGGCAATCAGATTGAGGTTGAAACTCGAGTTTCAACCTCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011811.3-1921s21c1
Sequence:CCGGGCTGGTGTGTATCTGCATGTACTCGAGTACATGCAGATACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-511s21c1
Sequence:CCGGCCCATTTACTTACACCGCGAACTCGAGTTCGCGGTGTAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-707s21c1
Sequence:CCGGCCGATTATAAATGGGAATCATCTCGAGATGATTCCCATTTATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-1035s21c1
Sequence:CCGGGCAATCAGATTGAGGTTGAAACTCGAGTTTCAACCTCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011811
FARSB MISSION shRNA shRNA Plasmid DNA
phenylalanyl-tRNA synthetase, beta subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011811.2-1924s1c1
Sequence:CCGGGCTGGTGTGTATCTGCATGTACTCGAGTACATGCAGATACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-710s1c1
Sequence:CCGGCCGATTATAAATGGGAATCATCTCGAGATGATTCCCATTTATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-515s1c1
Sequence:CCGGCCATTTACTTACACCGCGAAACTCGAGTTTCGCGGTGTAAGTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-514s1c1
Sequence:CCGGCCCATTTACTTACACCGCGAACTCGAGTTCGCGGTGTAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-1038s1c1
Sequence:CCGGGCAATCAGATTGAGGTTGAAACTCGAGTTTCAACCTCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011811.3-1921s21c1
Sequence:CCGGGCTGGTGTGTATCTGCATGTACTCGAGTACATGCAGATACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-511s21c1
Sequence:CCGGCCCATTTACTTACACCGCGAACTCGAGTTCGCGGTGTAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-707s21c1
Sequence:CCGGCCGATTATAAATGGGAATCATCTCGAGATGATTCCCATTTATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-1035s21c1
Sequence:CCGGGCAATCAGATTGAGGTTGAAACTCGAGTTTCAACCTCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011811
FARSB MISSION shRNA Lentiviral Transduction Particles
phenylalanyl-tRNA synthetase, beta subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011811.2-1924s1c1
Sequence:CCGGGCTGGTGTGTATCTGCATGTACTCGAGTACATGCAGATACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-710s1c1
Sequence:CCGGCCGATTATAAATGGGAATCATCTCGAGATGATTCCCATTTATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-515s1c1
Sequence:CCGGCCATTTACTTACACCGCGAAACTCGAGTTTCGCGGTGTAAGTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-514s1c1
Sequence:CCGGCCCATTTACTTACACCGCGAACTCGAGTTCGCGGTGTAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011811.2-1038s1c1
Sequence:CCGGGCAATCAGATTGAGGTTGAAACTCGAGTTTCAACCTCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011811.3-1921s21c1
Sequence:CCGGGCTGGTGTGTATCTGCATGTACTCGAGTACATGCAGATACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-511s21c1
Sequence:CCGGCCCATTTACTTACACCGCGAACTCGAGTTCGCGGTGTAAGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-707s21c1
Sequence:CCGGCCGATTATAAATGGGAATCATCTCGAGATGATTCCCATTTATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011811.3-1035s21c1
Sequence:CCGGGCAATCAGATTGAGGTTGAAACTCGAGTTTCAACCTCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks