EMAIL THIS PAGE TO A FRIEND

FAS

Fas cell surface death receptor

181 Gene Product Result for
Synonyms: ALPS1A APO-1 APT1 CD95 FAS1 FASTM TNFRSF6
Gene ID:
Human(355) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
Mouse(14102) Fas (TNF receptor superfamily member 6)
Rat(246097) Fas cell surface death receptor
Zebrafish(768248) Fas (TNF receptor superfamily, member 6)
fruit fly(36521) faint sausage
domestic cat(493881) Fas (TNF receptor superfamily, member 6)
cow(282488) Fas (TNF receptor superfamily, member 6)
Horse(100071639) Fas (TNF receptor superfamily, member 6)
dog(486469) Fas (TNF receptor superfamily, member 6)
chicken(395274) Fas (TNF receptor superfamily, member 6)
domestic guinea pig(100726403) Fas cell surface death receptor
naked mole-rat(101704746) Fas cell surface death receptor
sheep(100144426) Fas (TNF receptor superfamily, member 6)
Domestic Rabbit(100008609) Fas (TNF receptor superfamily, member 6)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22766 Anti-FAS (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
GW22767 Anti-FAS (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501317 Anti-FAS antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA027444 Anti-FAS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105218 Anti-FAS antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4501532 Anti-FAS, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB4501533 Anti-FAS, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4301110 Anti-TNFRSF6 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4700005 Monoclonal Anti-CD95 antibody produced in mouse clone LT95, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700009 Monoclonal Anti-CD95 azide free antibody produced in mouse clone UT-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700006 Monoclonal Anti-CD95-APC antibody produced in mouse clone LT95, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry pricing
SAB4700007 Monoclonal Anti-CD95-FITC antibody produced in mouse clone LT95, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700008 Monoclonal Anti-CD95-PE antibody produced in mouse clone LT95, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F4424 Monoclonal Anti-Fas (CD95/Apo-1) antibody produced in mouse clone DX2, purified immunoglobulin, buffered aqueous solution human
flow cytometry, microarray pricing
F4229 Monoclonal Anti-Fas (CD95/Apo-1)−FITC antibody produced in mouse clone DX2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0000355M5 Monoclonal Anti-FAS antibody produced in mouse clone 2G3, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB1403561 Monoclonal Anti-FAS antibody produced in mouse clone 5B4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000043 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000043 Rosetta Predictions human pricing
NM_152871 Rosetta Predictions human pricing
NM_152872 Rosetta Predictions human pricing
NM_152873 Rosetta Predictions human pricing
NM_152874 Rosetta Predictions human pricing
NM_152875 Rosetta Predictions human pricing
NM_152876 Rosetta Predictions human pricing
NM_152877 Rosetta Predictions human pricing
NM_139194 Rosetta Predictions rat pricing
NM_007987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301734 predicted 1370
2 SASI_Hs02_00301735 predicted 1812
3 SASI_Hs01_00079050 predicted 1592
4 SASI_Hs01_00079051 predicted 1246
5 SASI_Hs01_00079052 predicted 1784
6 SASI_Hs01_00079054 predicted 1637
7 SASI_Hs01_00079055 predicted 1376
8 SASI_Hs01_00079058 predicted 1612
9 SASI_Hs01_00079059 predicted 1746
10 SASI_Hs02_00301736 predicted 1713
11 SASI_Hs01_00079053 predicted 1714
12 SASI_Hs01_00079056 predicted 1618
13 SASI_Hs01_00079057 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366814 predicted 1302
2 SASI_Hs02_00366815 predicted 1753
3 SASI_Hs01_00136240 predicted 1530
4 SASI_Hs01_00136241 predicted 1183
5 SASI_Hs01_00136242 predicted 1715
6 SASI_Hs01_00136244 predicted 1572
7 SASI_Hs01_00136245 predicted 1316
8 SASI_Hs01_00136248 predicted 1545
9 SASI_Hs01_00136249 predicted 1681
10 SASI_Hs02_00366816 predicted 1647
11 SASI_Hs01_00136243 predicted 1651
12 SASI_Hs01_00136246 predicted 1556
13 SASI_Hs01_00136247 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366817 predicted 1220
2 SASI_Hs01_00163106 predicted 1352
3 SASI_Hs01_00163108 predicted 1036
4 SASI_Hs01_00163109 predicted 966
5 SASI_Hs01_00163110 predicted 778
6 SASI_Hs01_00163111 predicted 897
7 SASI_Hs01_00163112 predicted 1047
8 SASI_Hs02_00366818 predicted 993
9 SASI_Hs01_00163113 predicted 724
10 SASI_Hs01_00163114 predicted 1030
11 SASI_Hs01_00163107 predicted 434
12 SASI_Hs01_00163115 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366819 predicted 1133
2 SASI_Hs01_00115869 predicted 1267
3 SASI_Hs01_00115870 predicted 857
4 SASI_Hs01_00115872 predicted 887
5 SASI_Hs01_00115873 predicted 883
6 SASI_Hs02_00366820 predicted 872
7 SASI_Hs01_00115874 predicted 783
8 SASI_Hs01_00115875 predicted 780
9 SASI_Hs01_00115876 predicted 853
10 SASI_Hs01_00115877 predicted 675
11 SASI_Hs01_00115871 predicted 436
12 SASI_Hs01_00115878 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366821 predicted 1056
2 SASI_Hs01_00044307 predicted 1186
3 SASI_Hs01_00044310 predicted 867
4 SASI_Hs01_00044311 predicted 811
5 SASI_Hs02_00366822 predicted 842
6 SASI_Hs02_00366823 predicted 814
7 SASI_Hs02_00366824 predicted 646
8 SASI_Hs02_00366825 predicted 659
9 SASI_Hs01_00044312 predicted 878
10 SASI_Hs01_00044313 predicted 862
11 SASI_Hs01_00044308 predicted 378
12 SASI_Hs01_00044309 predicted 426
13 SASI_Hs01_00044314 predicted 685
14 SASI_Hs01_00044315 predicted 394
15 SASI_Hs01_00044316 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366826 predicted 1072
2 SASI_Hs01_00174906 predicted 1205
3 SASI_Hs01_00174908 predicted 793
4 SASI_Hs01_00174910 predicted 1037
5 SASI_Hs01_00174911 predicted 1039
6 SASI_Hs01_00174912 predicted 824
7 SASI_Hs01_00174913 predicted 858
8 SASI_Hs01_00174914 predicted 996
9 SASI_Hs01_00174915 predicted 829
10 SASI_Hs02_00366827 predicted 805
11 SASI_Hs01_00174907 predicted 374
12 SASI_Hs01_00174909 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366828 predicted 938
2 SASI_Hs01_00027966 predicted 1068
3 SASI_Hs01_00027968 predicted 661
4 SASI_Hs01_00027970 predicted 748
5 SASI_Hs01_00027971 predicted 900
6 SASI_Hs02_00366829 predicted 895
7 SASI_Hs01_00027973 predicted 682
8 SASI_Hs01_00027974 predicted 855
9 SASI_Hs02_00366830 predicted 693
10 SASI_Hs02_00366831 predicted 669
11 SASI_Hs01_00027967 predicted 382
12 SASI_Hs01_00027969 predicted 432
13 SASI_Hs01_00027972 predicted 699
14 SASI_Hs01_00027975 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366832 predicted 996
2 SASI_Hs01_00167877 predicted 1127
3 SASI_Hs02_00366833 predicted 724
4 SASI_Hs02_00366834 predicted 809
5 SASI_Hs02_00366835 predicted 753
6 SASI_Hs02_00366836 predicted 745
7 SASI_Hs02_00366837 predicted 914
8 SASI_Hs02_00366838 predicted 731
9 SASI_Hs02_00366839 predicted 651
10 SASI_Hs02_00366840 predicted 830
11 SASI_Hs01_00167876 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031606 predicted 1009
2 SASI_Rn01_00031607 predicted 1069
3 SASI_Rn01_00031608 predicted 665
4 SASI_Rn01_00031609 predicted 590
5 SASI_Rn01_00031611 predicted 250
6 SASI_Rn01_00031612 predicted 433
7 SASI_Rn01_00031613 predicted 1117
8 SASI_Rn02_00268524 predicted 690
9 SASI_Rn01_00031614 predicted 688
10 SASI_Rn01_00031615 predicted 858
11 SASI_Rn01_00031610 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032453 predicted 926
2 SASI_Mm01_00032454 predicted 738
3 SASI_Mm01_00032455 predicted 678
4 SASI_Mm01_00032456 predicted 552
5 SASI_Mm01_00032457 predicted 474
6 SASI_Mm01_00032459 predicted 696
7 SASI_Mm01_00032460 predicted 541
8 SASI_Mm01_00032461 predicted 896
9 SASI_Mm02_00312900 predicted 645
10 SASI_Mm01_00032462 predicted 591
11 SASI_Mm01_00032458 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007987
VALIDATED
FAS MISSION shRNA Bacterial Glycerol Stock
Fas cell surface death receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-731s21c1
Sequence:CCGGCCCGAGAATTGCTGAAGACATCTCGAGATGTCTTCAGCAATTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-703s21c1
Sequence:CCGGCCTCAAATCTTAGCTTGAGTACTCGAGTACTCAAGCTAAGATTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007987.2-1139s21c1
Sequence:CCGGGTGTTCTCTTTGCCAGCAAATCTCGAGATTTGCTGGCAAAGAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-538s21c1
Sequence:CCGGGCAGGAAACAAAGTCCCAGAACTCGAGTTCTGGGACTTTGTTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-1132s1c1
Sequence:CCGGGTGTTCTCTTTGCCAGCAAATCTCGAGATTTGCTGGCAAAGAGAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-696s1c1
Sequence:CCGGCCTCAAATCTTAGCTTGAGTACTCGAGTACTCAAGCTAAGATTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-724s1c1
Sequence:CCGGCCCGAGAATTGCTGAAGACATCTCGAGATGTCTTCAGCAATTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-531s1c1
Sequence:CCGGGCAGGAAACAAAGTCCCAGAACTCGAGTTCTGGGACTTTGTTTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-90s1c1
Sequence:CCGGGCTCACAGTTAAGAGTTCATACTCGAGTATGAACTCTTAACTGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007987
VALIDATED
FAS MISSION shRNA shRNA Plasmid DNA
Fas cell surface death receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-731s21c1
Sequence:CCGGCCCGAGAATTGCTGAAGACATCTCGAGATGTCTTCAGCAATTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-703s21c1
Sequence:CCGGCCTCAAATCTTAGCTTGAGTACTCGAGTACTCAAGCTAAGATTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007987.2-1139s21c1
Sequence:CCGGGTGTTCTCTTTGCCAGCAAATCTCGAGATTTGCTGGCAAAGAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-538s21c1
Sequence:CCGGGCAGGAAACAAAGTCCCAGAACTCGAGTTCTGGGACTTTGTTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-1132s1c1
Sequence:CCGGGTGTTCTCTTTGCCAGCAAATCTCGAGATTTGCTGGCAAAGAGAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-696s1c1
Sequence:CCGGCCTCAAATCTTAGCTTGAGTACTCGAGTACTCAAGCTAAGATTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-724s1c1
Sequence:CCGGCCCGAGAATTGCTGAAGACATCTCGAGATGTCTTCAGCAATTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-531s1c1
Sequence:CCGGGCAGGAAACAAAGTCCCAGAACTCGAGTTCTGGGACTTTGTTTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-90s1c1
Sequence:CCGGGCTCACAGTTAAGAGTTCATACTCGAGTATGAACTCTTAACTGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007987
VALIDATED
FAS MISSION shRNA Lentiviral Transduction Particles
Fas cell surface death receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-731s21c1
Sequence:CCGGCCCGAGAATTGCTGAAGACATCTCGAGATGTCTTCAGCAATTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-703s21c1
Sequence:CCGGCCTCAAATCTTAGCTTGAGTACTCGAGTACTCAAGCTAAGATTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007987.2-1139s21c1
Sequence:CCGGGTGTTCTCTTTGCCAGCAAATCTCGAGATTTGCTGGCAAAGAGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007987.2-538s21c1
Sequence:CCGGGCAGGAAACAAAGTCCCAGAACTCGAGTTCTGGGACTTTGTTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-1132s1c1
Sequence:CCGGGTGTTCTCTTTGCCAGCAAATCTCGAGATTTGCTGGCAAAGAGAACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-696s1c1
Sequence:CCGGCCTCAAATCTTAGCTTGAGTACTCGAGTACTCAAGCTAAGATTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-724s1c1
Sequence:CCGGCCCGAGAATTGCTGAAGACATCTCGAGATGTCTTCAGCAATTCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-531s1c1
Sequence:CCGGGCAGGAAACAAAGTCCCAGAACTCGAGTTCTGGGACTTTGTTTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007987.1-90s1c1
Sequence:CCGGGCTCACAGTTAAGAGTTCATACTCGAGTATGAACTCTTAACTGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000043
VALIDATED
FAS MISSION shRNA Bacterial Glycerol Stock
Fas cell surface death receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000043.3-1281s21c1
Sequence:GTACCGGCTATCATCCTCAAGGACATTACTCGAGTAATGTCCTTGAGGATGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-2486s21c1
Sequence:CCGGATATCTTTGAAAGTTTGTATTCTCGAGAATACAAACTTTCAAAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-1441s21c1
Sequence:CCGGTTTTACTGGGTACATTTTATCCTCGAGGATAAAATGTACCCAGTAAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-2629s21c1
Sequence:CCGGCCCTTGTGTTTGGAATTATAACTCGAGTTATAATTCCAAACACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-1984s21c1
Sequence:CCGGTTAAATTATAATGTTTGACTACTCGAGTAGTCAAACATTATAATTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-389s1c1
Sequence:CCGGGTTGCTAGATTATCGTCCAAACTCGAGTTTGGACGATAATCTAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-840s1c1
Sequence:CCGGGCAAAGAGGAAGGATCCAGATCTCGAGATCTGGATCCTTCCTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-995s1c1
Sequence:CCGGCCTGAAACAGTGGCAATAAATCTCGAGATTTATTGCCACTGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-724s1c1
Sequence:CCGGGTGCAGATGTAAACCAAACTTCTCGAGAAGTTTGGTTTACATCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000043
VALIDATED
FAS MISSION shRNA shRNA Plasmid DNA
Fas cell surface death receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000043.3-1281s21c1
Sequence:GTACCGGCTATCATCCTCAAGGACATTACTCGAGTAATGTCCTTGAGGATGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-2486s21c1
Sequence:CCGGATATCTTTGAAAGTTTGTATTCTCGAGAATACAAACTTTCAAAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-1441s21c1
Sequence:CCGGTTTTACTGGGTACATTTTATCCTCGAGGATAAAATGTACCCAGTAAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-2629s21c1
Sequence:CCGGCCCTTGTGTTTGGAATTATAACTCGAGTTATAATTCCAAACACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-1984s21c1
Sequence:CCGGTTAAATTATAATGTTTGACTACTCGAGTAGTCAAACATTATAATTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-389s1c1
Sequence:CCGGGTTGCTAGATTATCGTCCAAACTCGAGTTTGGACGATAATCTAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-840s1c1
Sequence:CCGGGCAAAGAGGAAGGATCCAGATCTCGAGATCTGGATCCTTCCTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-995s1c1
Sequence:CCGGCCTGAAACAGTGGCAATAAATCTCGAGATTTATTGCCACTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-724s1c1
Sequence:CCGGGTGCAGATGTAAACCAAACTTCTCGAGAAGTTTGGTTTACATCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000043
VALIDATED
FAS MISSION shRNA Lentiviral Transduction Particles
Fas cell surface death receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000043.3-1281s21c1
Sequence:GTACCGGCTATCATCCTCAAGGACATTACTCGAGTAATGTCCTTGAGGATGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-2486s21c1
Sequence:CCGGATATCTTTGAAAGTTTGTATTCTCGAGAATACAAACTTTCAAAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-1441s21c1
Sequence:CCGGTTTTACTGGGTACATTTTATCCTCGAGGATAAAATGTACCCAGTAAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-2629s21c1
Sequence:CCGGCCCTTGTGTTTGGAATTATAACTCGAGTTATAATTCCAAACACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000043.3-1984s21c1
Sequence:CCGGTTAAATTATAATGTTTGACTACTCGAGTAGTCAAACATTATAATTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-389s1c1
Sequence:CCGGGTTGCTAGATTATCGTCCAAACTCGAGTTTGGACGATAATCTAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-840s1c1
Sequence:CCGGGCAAAGAGGAAGGATCCAGATCTCGAGATCTGGATCCTTCCTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-995s1c1
Sequence:CCGGCCTGAAACAGTGGCAATAAATCTCGAGATTTATTGCCACTGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000043.3-724s1c1
Sequence:CCGGGTGCAGATGTAAACCAAACTTCTCGAGAAGTTTGGTTTACATCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)