EMAIL THIS PAGE TO A FRIEND

FASLG

Fas ligand (TNF superfamily, member 6)

158 Gene Product Result for
Synonyms: ALPS1B APT1LG1 APTL CD178 CD95-L CD95L FASL TNFSF6
UniProtKB ID: P48023, Q9BZP9
Gene ID:
Human(356) Summary: The protein encoded by this gene is the ligand for FAS. Both are transmembrane proteins. Interaction of FAS with this ligand is critical in triggering apoptosis of some types of cells such as lymphocytes. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
Rat(25385) Fas ligand (TNF superfamily, member 6)
sheep(100135696) Fas ligand (TNF superfamily, member 6)
naked mole-rat(101698642) Fas ligand (TNF superfamily, member 6)
domestic guinea pig(100714139) Fas ligand (TNF superfamily, member 6)
Zebrafish(735295) Fas ligand (TNF superfamily, member 6)
chicken(429064) Fas ligand (TNF superfamily, member 6)
dog(442968) Fas ligand (TNF superfamily, member 6)
domestic cat(493945) Fas ligand (TNF superfamily, member 6)
cow(407111) Fas ligand (TNF superfamily, member 6)
Horse(100052326) Fas ligand (TNF superfamily, member 6)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000639 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141661 MISSION® esiRNA esiRNA human FASLG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000639 Rosetta Predictions human pricing
NM_012908 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302991 predicted 1014
2 SASI_Hs01_00086610 predicted 1290
3 SASI_Hs01_00086612 predicted 1078
4 SASI_Hs02_00302992 predicted 1192
5 SASI_Hs01_00086613 predicted 1267
6 SASI_Hs02_00302993 predicted 1271
7 SASI_Hs01_00086614 predicted 783
8 SASI_Hs01_00086616 predicted 1023
9 SASI_Hs02_00302994 predicted 659
10 SASI_Hs01_00086618 predicted 1009
11 SASI_Hs01_00086611 predicted 724
12 SASI_Hs01_00086615 predicted 1286
13 SASI_Hs01_00086617 predicted 1298
14 SASI_Hs01_00086619 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042749 predicted 486
2 SASI_Rn01_00042750 predicted 409
3 SASI_Rn01_00042751 predicted 495
4 SASI_Rn01_00042752 predicted 293
5 SASI_Rn01_00042753 predicted 614
6 SASI_Rn01_00042754 predicted 269
7 SASI_Rn01_00042755 predicted 819
8 SASI_Rn01_00042756 predicted 691
9 SASI_Rn01_00042757 predicted 414
10 SASI_Rn02_00260444 predicted 418
11 SASI_Rn01_00042758 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000639
FASLG MISSION shRNA Bacterial Glycerol Stock
Fas ligand (TNF superfamily, member 6)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-597s1c1
Sequence:CCGGCCCATTTAACAGGCAAGTCCACTCGAGTGGACTTGCCTGTTAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-713s1c1
Sequence:CCGGACTGGGCTGTACTTTGTATATCTCGAGATATACAAAGTACAGCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-896s1c1
Sequence:CCGGGCAGTGTTCAATCTTACCAGTCTCGAGACTGGTAAGATTGAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-398s1c1
Sequence:CCGGCTGTGTCTCCTTGTGATGTTTCTCGAGAAACATCACAAGGAGACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-527s1c1
Sequence:CCGGGCATCATCTTTGGAGAAGCAACTCGAGTTGCTTCTCCAAAGATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000639.1-943s21c1
Sequence:CCGGTGAGCTCTCTCTGGTCAATTTCTCGAGAAATTGACCAGAGAGAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000639.1-1154s21c1
Sequence:CCGGTAGCTCCTCAACTCACCTAATCTCGAGATTAGGTGAGTTGAGGAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000639.1-1423s21c1
Sequence:CCGGGACTAGAGGCTTGCATAATAACTCGAGTTATTATGCAAGCCTCTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000639
FASLG MISSION shRNA shRNA Plasmid DNA
Fas ligand (TNF superfamily, member 6)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-597s1c1
Sequence:CCGGCCCATTTAACAGGCAAGTCCACTCGAGTGGACTTGCCTGTTAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-713s1c1
Sequence:CCGGACTGGGCTGTACTTTGTATATCTCGAGATATACAAAGTACAGCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-896s1c1
Sequence:CCGGGCAGTGTTCAATCTTACCAGTCTCGAGACTGGTAAGATTGAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-398s1c1
Sequence:CCGGCTGTGTCTCCTTGTGATGTTTCTCGAGAAACATCACAAGGAGACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-527s1c1
Sequence:CCGGGCATCATCTTTGGAGAAGCAACTCGAGTTGCTTCTCCAAAGATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000639.1-943s21c1
Sequence:CCGGTGAGCTCTCTCTGGTCAATTTCTCGAGAAATTGACCAGAGAGAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000639.1-1154s21c1
Sequence:CCGGTAGCTCCTCAACTCACCTAATCTCGAGATTAGGTGAGTTGAGGAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000639.1-1423s21c1
Sequence:CCGGGACTAGAGGCTTGCATAATAACTCGAGTTATTATGCAAGCCTCTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000639
FASLG MISSION shRNA Lentiviral Transduction Particles
Fas ligand (TNF superfamily, member 6)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-597s1c1
Sequence:CCGGCCCATTTAACAGGCAAGTCCACTCGAGTGGACTTGCCTGTTAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-713s1c1
Sequence:CCGGACTGGGCTGTACTTTGTATATCTCGAGATATACAAAGTACAGCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-896s1c1
Sequence:CCGGGCAGTGTTCAATCTTACCAGTCTCGAGACTGGTAAGATTGAACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-398s1c1
Sequence:CCGGCTGTGTCTCCTTGTGATGTTTCTCGAGAAACATCACAAGGAGACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000639.1-527s1c1
Sequence:CCGGGCATCATCTTTGGAGAAGCAACTCGAGTTGCTTCTCCAAAGATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000639.1-943s21c1
Sequence:CCGGTGAGCTCTCTCTGGTCAATTTCTCGAGAAATTGACCAGAGAGAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000639.1-1154s21c1
Sequence:CCGGTAGCTCCTCAACTCACCTAATCTCGAGATTAGGTGAGTTGAGGAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000639.1-1423s21c1
Sequence:CCGGGACTAGAGGCTTGCATAATAACTCGAGTTATTATGCAAGCCTCTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)