EMAIL THIS PAGE TO A FRIEND

FASN

fatty acid synthase

204 Gene Product Result for
Synonyms: FAS OA-519 SDR27X1
Gene ID:
Human(2194) Summary: The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]
Mouse(14104) fatty acid synthase
Rat(50671) fatty acid synthase
Zebrafish(335859) fatty acid synthase
chicken(396061) fatty acid synthase
cow(281152) fatty acid synthase
Horse(100057311) fatty acid synthase
domestic cat(100270775) fatty acid synthase
dog(483378) fatty acid synthase
domestic guinea pig(100714828) fatty acid synthase
naked mole-rat(101698314) fatty acid synthase
Goat(100861286) fatty acid synthase
sheep(100170327) fatty acid synthase
Gene Class: Dehydratase, Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C2389 Cerulenin ≥98% (HPLC), from Cephalosporium caerulens human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004104 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130711 MISSION® esiRNA esiRNA human FASN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004104 Rosetta Predictions human pricing
NM_017332 Rosetta Predictions rat pricing
NM_007988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057849 predicted 1744
2 SASI_Hs01_00057850 predicted 5635
3 SASI_Hs02_00336920 predicted 6204
4 SASI_Hs01_00057851 predicted 7211
5 SASI_Hs01_00057852 predicted 6972
6 SASI_Hs01_00057853 predicted 6062
7 SASI_Hs02_00336921 predicted 4822
8 SASI_Hs01_00057855 predicted 868
9 SASI_Hs01_00057856 predicted 3390
10 SASI_Hs01_00057857 predicted 2492
11 SASI_Hs01_00057854 predicted 2609
12 SASI_Hs01_00057858 predicted 7431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261786 predicted 6029
2 SASI_Rn01_00080636 predicted 1480
3 SASI_Rn01_00080638 predicted 6139
4 SASI_Rn01_00080639 predicted 651
5 SASI_Rn01_00080640 predicted 344
6 SASI_Rn01_00080641 predicted 3088
7 SASI_Rn01_00080642 predicted 6914
8 SASI_Rn02_00261787 predicted 6262
9 SASI_Rn01_00080645 predicted 7371
10 SASI_Rn02_00261788 predicted 1792
11 SASI_Rn01_00080637 predicted 5799
12 SASI_Rn01_00080643 predicted 6261
13 SASI_Rn01_00080644 predicted 5612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177854 predicted 6992
2 SASI_Mm01_00177855 predicted 6577
3 SASI_Mm01_00177856 predicted 3153
4 SASI_Mm02_00312901 predicted 2143
5 SASI_Mm01_00177858 predicted 6596
6 SASI_Mm01_00177859 predicted 3615
7 SASI_Mm01_00177860 predicted 784
8 SASI_Mm01_00177861 predicted 2877
9 SASI_Mm01_00177862 predicted 3270
10 SASI_Mm02_00312902 predicted 6052
11 SASI_Mm01_00177857 predicted 2117
12 SASI_Mm01_00177863 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007988
VALIDATED
FASN MISSION shRNA Bacterial Glycerol Stock
fatty acid synthase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-5456s21c1
Sequence:CCGGCGTCTATACCACTGCTTACTACTCGAGTAGTAAGCAGTGGTATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007988.3-8334s21c1
Sequence:CCGGGCTGGTCGTTTCTCCATTAAACTCGAGTTTAATGGAGAAACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-7058s21c1
Sequence:CCGGGCTGCGGAAACTTCAGGAAATCTCGAGATTTCCTGAAGTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-2874s21c1
Sequence:CCGGCCCTTGATGAAGAGGGATCATCTCGAGATGATCCCTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-7851s1c1
Sequence:CCGGGCTGGTCGTTTCTCCATTAAACTCGAGTTTAATGGAGAAACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-4970s1c1
Sequence:CCGGCGTCGTCTATACCACTGCTTACTCGAGTAAGCAGTGGTATAGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-2391s1c1
Sequence:CCGGCCCTTGATGAAGAGGGATCATCTCGAGATGATCCCTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-4973s1c1
Sequence:CCGGCGTCTATACCACTGCTTACTACTCGAGTAGTAAGCAGTGGTATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-6575s1c1
Sequence:CCGGGCTGCGGAAACTTCAGGAAATCTCGAGATTTCCTGAAGTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007988
VALIDATED
FASN MISSION shRNA shRNA Plasmid DNA
fatty acid synthase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-5456s21c1
Sequence:CCGGCGTCTATACCACTGCTTACTACTCGAGTAGTAAGCAGTGGTATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007988.3-8334s21c1
Sequence:CCGGGCTGGTCGTTTCTCCATTAAACTCGAGTTTAATGGAGAAACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-7058s21c1
Sequence:CCGGGCTGCGGAAACTTCAGGAAATCTCGAGATTTCCTGAAGTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-2874s21c1
Sequence:CCGGCCCTTGATGAAGAGGGATCATCTCGAGATGATCCCTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-7851s1c1
Sequence:CCGGGCTGGTCGTTTCTCCATTAAACTCGAGTTTAATGGAGAAACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-4970s1c1
Sequence:CCGGCGTCGTCTATACCACTGCTTACTCGAGTAAGCAGTGGTATAGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-2391s1c1
Sequence:CCGGCCCTTGATGAAGAGGGATCATCTCGAGATGATCCCTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-4973s1c1
Sequence:CCGGCGTCTATACCACTGCTTACTACTCGAGTAGTAAGCAGTGGTATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-6575s1c1
Sequence:CCGGGCTGCGGAAACTTCAGGAAATCTCGAGATTTCCTGAAGTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007988
VALIDATED
FASN MISSION shRNA Lentiviral Transduction Particles
fatty acid synthase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-5456s21c1
Sequence:CCGGCGTCTATACCACTGCTTACTACTCGAGTAGTAAGCAGTGGTATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007988.3-8334s21c1
Sequence:CCGGGCTGGTCGTTTCTCCATTAAACTCGAGTTTAATGGAGAAACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-7058s21c1
Sequence:CCGGGCTGCGGAAACTTCAGGAAATCTCGAGATTTCCTGAAGTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007988.3-2874s21c1
Sequence:CCGGCCCTTGATGAAGAGGGATCATCTCGAGATGATCCCTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-7851s1c1
Sequence:CCGGGCTGGTCGTTTCTCCATTAAACTCGAGTTTAATGGAGAAACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-4970s1c1
Sequence:CCGGCGTCGTCTATACCACTGCTTACTCGAGTAAGCAGTGGTATAGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-2391s1c1
Sequence:CCGGCCCTTGATGAAGAGGGATCATCTCGAGATGATCCCTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-4973s1c1
Sequence:CCGGCGTCTATACCACTGCTTACTACTCGAGTAGTAAGCAGTGGTATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007988.1-6575s1c1
Sequence:CCGGGCTGCGGAAACTTCAGGAAATCTCGAGATTTCCTGAAGTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004104
VALIDATED
FASN MISSION shRNA Bacterial Glycerol Stock
fatty acid synthase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-5499s21c1
Sequence:CCGGCCTACTGGATGCGTTCTTCAACTCGAGTTGAAGAACGCATCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004104.4-7786s21c1
Sequence:CCGGGCTGCTAGATGTAGGTGTTAGCTCGAGCTAACACCTACATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-6237s21c1
Sequence:CCGGCATGGAGCGTATCTGTGAGAACTCGAGTTCTCACAGATACGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-1743s21c1
Sequence:CCGGCGAGAGCACCTTTGATGACATCTCGAGATGTCATCAAAGGTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-5503s1c1
Sequence:CCGGCCTACTGGATGCGTTCTTCAACTCGAGTTGAAGAACGCATCCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-3120s1c1
Sequence:CCGGGCTACGACTACGGCCCTCATTCTCGAGAATGAGGGCCGTAGTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-1753s1c1
Sequence:CCGGCGAGAGCACCTTTGATGACATCTCGAGATGTCATCAAAGGTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004104.x-8432s1c1
Sequence:CCGGCCTCCCACAATTAAACCGCATCTCGAGATGCGGTTTAATTGTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004104.x-6241s1c1
Sequence:CCGGCATGGAGCGTATCTGTGAGAACTCGAGTTCTCACAGATACGCTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004104
VALIDATED
FASN MISSION shRNA shRNA Plasmid DNA
fatty acid synthase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-5499s21c1
Sequence:CCGGCCTACTGGATGCGTTCTTCAACTCGAGTTGAAGAACGCATCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004104.4-7786s21c1
Sequence:CCGGGCTGCTAGATGTAGGTGTTAGCTCGAGCTAACACCTACATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-6237s21c1
Sequence:CCGGCATGGAGCGTATCTGTGAGAACTCGAGTTCTCACAGATACGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-1743s21c1
Sequence:CCGGCGAGAGCACCTTTGATGACATCTCGAGATGTCATCAAAGGTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-5503s1c1
Sequence:CCGGCCTACTGGATGCGTTCTTCAACTCGAGTTGAAGAACGCATCCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-3120s1c1
Sequence:CCGGGCTACGACTACGGCCCTCATTCTCGAGAATGAGGGCCGTAGTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-1753s1c1
Sequence:CCGGCGAGAGCACCTTTGATGACATCTCGAGATGTCATCAAAGGTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004104.x-8432s1c1
Sequence:CCGGCCTCCCACAATTAAACCGCATCTCGAGATGCGGTTTAATTGTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004104.x-6241s1c1
Sequence:CCGGCATGGAGCGTATCTGTGAGAACTCGAGTTCTCACAGATACGCTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004104
VALIDATED
FASN MISSION shRNA Lentiviral Transduction Particles
fatty acid synthase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-5499s21c1
Sequence:CCGGCCTACTGGATGCGTTCTTCAACTCGAGTTGAAGAACGCATCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004104.4-7786s21c1
Sequence:CCGGGCTGCTAGATGTAGGTGTTAGCTCGAGCTAACACCTACATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-6237s21c1
Sequence:CCGGCATGGAGCGTATCTGTGAGAACTCGAGTTCTCACAGATACGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004104.4-1743s21c1
Sequence:CCGGCGAGAGCACCTTTGATGACATCTCGAGATGTCATCAAAGGTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-5503s1c1
Sequence:CCGGCCTACTGGATGCGTTCTTCAACTCGAGTTGAAGAACGCATCCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-3120s1c1
Sequence:CCGGGCTACGACTACGGCCCTCATTCTCGAGAATGAGGGCCGTAGTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004104.x-1753s1c1
Sequence:CCGGCGAGAGCACCTTTGATGACATCTCGAGATGTCATCAAAGGTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004104.x-8432s1c1
Sequence:CCGGCCTCCCACAATTAAACCGCATCTCGAGATGCGGTTTAATTGTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004104.x-6241s1c1
Sequence:CCGGCATGGAGCGTATCTGTGAGAACTCGAGTTCTCACAGATACGCTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks