EMAIL THIS PAGE TO A FRIEND

FASTKD2

FAST kinase domains 2

181 Gene Product Result for
Synonyms: KIAA0971
UniProtKB ID: Q9NYY8, Q9NVX6, Q9Y2H7
Gene ID:
Human(22868) Summary: This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Mouse(75619) FAST kinase domains 2
Rat(301463) FAST kinase domains 2
Zebrafish(564382) FAST kinase domains 2
chicken(424096) FAST kinase domains 2
cow(528207) FAST kinase domains 2
Horse(100068684) FAST kinase domains 2
domestic cat(101097009) FAST kinase domains 2
dog(478884) FAST kinase domains 2
sheep(101116708) FAST kinase domains 2
naked mole-rat(101714635) FAST kinase domains 2
domestic guinea pig(100718328) FAST kinase domains 2
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014929 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014929 Rosetta Predictions human pricing
NM_001009673 Rosetta Predictions rat pricing
NM_172422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068215 predicted 2204
2 SASI_Hs01_00068217 predicted 614
3 SASI_Hs01_00068218 predicted 1114
4 SASI_Hs01_00068220 predicted 2267
5 SASI_Hs02_00346588 predicted 357
6 SASI_Hs02_00346589 predicted 1420
7 SASI_Hs01_00068221 predicted 640
8 SASI_Hs01_00068222 predicted 2258
9 SASI_Hs01_00068223 predicted 898
10 SASI_Hs01_00068224 predicted 1896
11 SASI_Hs01_00068216 predicted 758
12 SASI_Hs01_00068219 predicted 2062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087436 predicted 1055
2 SASI_Rn01_00087437 predicted 579
3 SASI_Rn02_00199709 predicted 222
4 SASI_Rn01_00087438 predicted 1112
5 SASI_Rn02_00199710 predicted 844
6 SASI_Rn01_00087440 predicted 1617
7 SASI_Rn01_00087442 predicted 420
8 SASI_Rn01_00087443 predicted 1185
9 SASI_Rn01_00087444 predicted 895
10 SASI_Rn01_00087445 predicted 924
11 SASI_Rn01_00087439 predicted 235
12 SASI_Rn01_00087441 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123132 predicted 1203
2 SASI_Mm01_00123133 predicted 278
3 SASI_Mm01_00123134 predicted 631
4 SASI_Mm01_00123135 predicted 331
5 SASI_Mm01_00123136 predicted 2271
6 SASI_Mm01_00123137 predicted 595
7 SASI_Mm01_00123138 predicted 958
8 SASI_Mm01_00123139 predicted 1275
9 SASI_Mm02_00343896 predicted 778
10 SASI_Mm02_00343897 predicted 2213
11 SASI_Mm01_00123140 predicted 1731
12 SASI_Mm01_00123141 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172422
VALIDATED
FASTKD2 MISSION shRNA Bacterial Glycerol Stock
FAST kinase domains 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000175493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172422.1-2773s1c1
Sequence:CCGGCCACCAATAACCTTGGAAGATCTCGAGATCTTCCAAGGTTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-307s1c1
Sequence:CCGGGTTAGATACCTCTTTCAGGATCTCGAGATCCTGAAAGAGGTATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-1635s1c1
Sequence:CCGGCCAGCTTATCAAAGAGAATATCTCGAGATATTCTCTTTGATAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-1443s1c1
Sequence:CCGGCGTGAAGAACATCGTTTCTATCTCGAGATAGAAACGATGTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172422
VALIDATED
FASTKD2 MISSION shRNA shRNA Plasmid DNA
FAST kinase domains 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000175493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172422.1-2773s1c1
Sequence:CCGGCCACCAATAACCTTGGAAGATCTCGAGATCTTCCAAGGTTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-307s1c1
Sequence:CCGGGTTAGATACCTCTTTCAGGATCTCGAGATCCTGAAAGAGGTATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-1635s1c1
Sequence:CCGGCCAGCTTATCAAAGAGAATATCTCGAGATATTCTCTTTGATAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-1443s1c1
Sequence:CCGGCGTGAAGAACATCGTTTCTATCTCGAGATAGAAACGATGTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172422
VALIDATED
FASTKD2 MISSION shRNA Lentiviral Transduction Particles
FAST kinase domains 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000175493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172422.1-2773s1c1
Sequence:CCGGCCACCAATAACCTTGGAAGATCTCGAGATCTTCCAAGGTTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-307s1c1
Sequence:CCGGGTTAGATACCTCTTTCAGGATCTCGAGATCCTGAAAGAGGTATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-1635s1c1
Sequence:CCGGCCAGCTTATCAAAGAGAATATCTCGAGATATTCTCTTTGATAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172422.1-1443s1c1
Sequence:CCGGCGTGAAGAACATCGTTTCTATCTCGAGATAGAAACGATGTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014929
VALIDATED
FASTKD2 MISSION shRNA Bacterial Glycerol Stock
FAST kinase domains 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-1346s1c1
Sequence:CCGGGCTTTCGACCTGTTGGTTTAACTCGAGTTAAACCAACAGGTCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-2557s1c1
Sequence:CCGGCTCCTGCTCTAAGCTGTTCTACTCGAGTAGAACAGCTTAGAGCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-585s1c1
Sequence:CCGGGCCCACATTTCCTAGTAGCAACTCGAGTTGCTACTAGGAAATGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-1117s1c1
Sequence:CCGGGCCATGAATCACCGATCTCTTCTCGAGAAGAGATCGGTGATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014929.2-2067s1c1
Sequence:CCGGCTTGGTCAATAACTGGGAGATCTCGAGATCTCCCAGTTATTGACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014929.2-847s1c1
Sequence:CCGGGAGTGTGATGAGATATGCCTTCTCGAGAAGGCATATCTCATCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2250s1c1
Sequence:CCGGCAAGTCAGTTGTCAATGGAATCTCGAGATTCCATTGACAACTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2529s1c1
Sequence:CCGGCCTTGTCTTTGGAATCTGAATCTCGAGATTCAGATTCCAAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-323s1c1
Sequence:CCGGGCTTTCAAACAAAGGGCATAACTCGAGTTATGCCCTTTGTTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2419s1c1
Sequence:CCGGGCCCAGATATTTGATTTGTGACTCGAGTCACAAATCAAATATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1377s21c1
Sequence:CCGGGCCATGAATCACCGATCTCTTCTCGAGAAGAGATCGGTGATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1107s21c1
Sequence:CCGGGAGTGTGATGAGATATGCCTTCTCGAGAAGGCATATCTCATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1606s21c1
Sequence:CCGGGCTTTCGACCTGTTGGTTTAACTCGAGTTAAACCAACAGGTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-583s21c1
Sequence:CCGGGCTTTCAAACAAAGGGCATAACTCGAGTTATGCCCTTTGTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014929
VALIDATED
FASTKD2 MISSION shRNA shRNA Plasmid DNA
FAST kinase domains 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-1346s1c1
Sequence:CCGGGCTTTCGACCTGTTGGTTTAACTCGAGTTAAACCAACAGGTCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-2557s1c1
Sequence:CCGGCTCCTGCTCTAAGCTGTTCTACTCGAGTAGAACAGCTTAGAGCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-585s1c1
Sequence:CCGGGCCCACATTTCCTAGTAGCAACTCGAGTTGCTACTAGGAAATGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-1117s1c1
Sequence:CCGGGCCATGAATCACCGATCTCTTCTCGAGAAGAGATCGGTGATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014929.2-2067s1c1
Sequence:CCGGCTTGGTCAATAACTGGGAGATCTCGAGATCTCCCAGTTATTGACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014929.2-847s1c1
Sequence:CCGGGAGTGTGATGAGATATGCCTTCTCGAGAAGGCATATCTCATCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2250s1c1
Sequence:CCGGCAAGTCAGTTGTCAATGGAATCTCGAGATTCCATTGACAACTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2529s1c1
Sequence:CCGGCCTTGTCTTTGGAATCTGAATCTCGAGATTCAGATTCCAAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-323s1c1
Sequence:CCGGGCTTTCAAACAAAGGGCATAACTCGAGTTATGCCCTTTGTTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2419s1c1
Sequence:CCGGGCCCAGATATTTGATTTGTGACTCGAGTCACAAATCAAATATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1377s21c1
Sequence:CCGGGCCATGAATCACCGATCTCTTCTCGAGAAGAGATCGGTGATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1107s21c1
Sequence:CCGGGAGTGTGATGAGATATGCCTTCTCGAGAAGGCATATCTCATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1606s21c1
Sequence:CCGGGCTTTCGACCTGTTGGTTTAACTCGAGTTAAACCAACAGGTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-583s21c1
Sequence:CCGGGCTTTCAAACAAAGGGCATAACTCGAGTTATGCCCTTTGTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014929
VALIDATED
FASTKD2 MISSION shRNA Lentiviral Transduction Particles
FAST kinase domains 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-1346s1c1
Sequence:CCGGGCTTTCGACCTGTTGGTTTAACTCGAGTTAAACCAACAGGTCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-2557s1c1
Sequence:CCGGCTCCTGCTCTAAGCTGTTCTACTCGAGTAGAACAGCTTAGAGCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-585s1c1
Sequence:CCGGGCCCACATTTCCTAGTAGCAACTCGAGTTGCTACTAGGAAATGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-1117s1c1
Sequence:CCGGGCCATGAATCACCGATCTCTTCTCGAGAAGAGATCGGTGATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014929.2-2067s1c1
Sequence:CCGGCTTGGTCAATAACTGGGAGATCTCGAGATCTCCCAGTTATTGACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014929.2-847s1c1
Sequence:CCGGGAGTGTGATGAGATATGCCTTCTCGAGAAGGCATATCTCATCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2250s1c1
Sequence:CCGGCAAGTCAGTTGTCAATGGAATCTCGAGATTCCATTGACAACTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2529s1c1
Sequence:CCGGCCTTGTCTTTGGAATCTGAATCTCGAGATTCAGATTCCAAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014929.2-323s1c1
Sequence:CCGGGCTTTCAAACAAAGGGCATAACTCGAGTTATGCCCTTTGTTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014929.2-2419s1c1
Sequence:CCGGGCCCAGATATTTGATTTGTGACTCGAGTCACAAATCAAATATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1377s21c1
Sequence:CCGGGCCATGAATCACCGATCTCTTCTCGAGAAGAGATCGGTGATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1107s21c1
Sequence:CCGGGAGTGTGATGAGATATGCCTTCTCGAGAAGGCATATCTCATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-1606s21c1
Sequence:CCGGGCTTTCGACCTGTTGGTTTAACTCGAGTTAAACCAACAGGTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014929.3-583s21c1
Sequence:CCGGGCTTTCAAACAAAGGGCATAACTCGAGTTATGCCCTTTGTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks