EMAIL THIS PAGE TO A FRIEND

FASTKD3

FAST kinase domains 3

64 Gene Product Result for
UniProtKB ID: Q14CZ7, Q9BVD3
Gene ID:
Human(79072) Summary: This gene encodes a member of a small family of Fas-activated serine/threonine kinase domain (FASTKD) containing proteins that share an amino terminal mitochondrial targeting domain and multiple carboxy terminal FAST domains as well as a putative RNA-binding RAP domain. The members of this family are ubiquitously expressed and are generally most abundant in mitochondria-enriched tissues such as heart, skeletal muscle and brown-adipose tissue. Some members of this protein family may play a role in apoptosis. The protein encoded by this gene interacts with components of the mitochondrial respiratory and translation networks. A pseudogene of this gene is also present on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(69577) FAST kinase domains 3
Rat(290946) FAST kinase domains 3
domestic guinea pig(100732551) FAST kinase domains 3
naked mole-rat(101719346) FAST kinase domains 3
sheep(101123663) FAST kinase domains 3
Zebrafish(100003734) FAST kinase domains 3
domestic cat(101098607) FAST kinase domains 3
dog(488053) FAST kinase domains 3
chicken(420932) FAST kinase domains 3
cow(513260) FAST kinase domains 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024091 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082291 MISSION® esiRNA esiRNA human FASTKD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024091 Rosetta Predictions human pricing
NM_001082574 Rosetta Predictions rat pricing
NM_027123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356567 predicted 604
2 SASI_Hs01_00114997 predicted 829
3 SASI_Hs02_00356568 predicted 772
4 SASI_Hs01_00114999 predicted 1139
5 SASI_Hs01_00115003 predicted 800
6 SASI_Hs01_00115004 predicted 908
7 SASI_Hs02_00356569 predicted 1999
8 SASI_Hs02_00356570 predicted 1489
9 SASI_Hs01_00115005 predicted 659
10 SASI_Hs02_00356571 predicted 1241
11 SASI_Hs01_00114996 predicted 463
12 SASI_Hs01_00114998 predicted 224
13 SASI_Hs01_00115000 predicted 1814
14 SASI_Hs01_00115001 predicted 825
15 SASI_Hs01_00115002 predicted 2032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208799 predicted 751
2 SASI_Rn02_00208800 predicted 1315
3 SASI_Rn02_00208801 predicted 794
4 SASI_Rn02_00208802 predicted 802
5 SASI_Rn02_00208803 predicted 1332
6 SASI_Rn02_00208804 predicted 1635
7 SASI_Rn02_00208805 predicted 206
8 SASI_Rn02_00208806 predicted 1749
9 SASI_Rn02_00208807 predicted 708
10 SASI_Rn02_00208808 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090777 predicted 978
2 SASI_Mm02_00331591 predicted 1795
3 SASI_Mm01_00090778 predicted 1438
4 SASI_Mm02_00331592 predicted 1848
5 SASI_Mm01_00090780 predicted 684
6 SASI_Mm02_00331593 predicted 1809
7 SASI_Mm01_00090782 predicted 1461
8 SASI_Mm02_00331594 predicted 1401
9 SASI_Mm01_00090783 predicted 1339
10 SASI_Mm02_00331595 predicted 1979
11 SASI_Mm01_00090776 predicted 1560
12 SASI_Mm01_00090779 predicted 1829
13 SASI_Mm01_00090781 predicted 1157
14 SASI_Mm01_00090784 predicted 597
15 SASI_Mm01_00090785 predicted 1294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027123
VALIDATED
FASTKD3 MISSION shRNA Bacterial Glycerol Stock
FAST kinase domains 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027123.4-2186s21c1
Sequence:CCGGAGCCACTCTATGGAAATTATGCTCGAGCATAATTTCCATAGAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1563s21c1
Sequence:CCGGGCAAGGTAAAGAGTCATATTTCTCGAGAAATATGACTCTTTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1344s21c1
Sequence:CCGGTAGTCAGATTGCCGAGCTAATCTCGAGATTAGCTCGGCAATCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-2094s21c1
Sequence:CCGGCTCCGCTGTCCACTGGTAATACTCGAGTATTACCAGTGGACAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1430s21c1
Sequence:CCGGATGTGCTCTGTGCCCGTTTACCTCGAGGTAAACGGGCACAGAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027123.2-1782s1c1
Sequence:CCGGCAAAGGTGTTGACGCCCTATTCTCGAGAATAGGGCGTCAACACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-457s1c1
Sequence:CCGGGCTGAGTTTCATAAGTGCCCTCTCGAGAGGGCACTTATGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-1352s1c1
Sequence:CCGGGAGCCATTTGGAAAGCTCAATCTCGAGATTGAGCTTTCCAAATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027123.2-2120s1c1
Sequence:CCGGGCTTACATCAAGACTTGAGTTCTCGAGAACTCAAGTCTTGATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-279s1c1
Sequence:CCGGGATTCCATCACGCATACTGTACTCGAGTACAGTATGCGTGATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027123
VALIDATED
FASTKD3 MISSION shRNA shRNA Plasmid DNA
FAST kinase domains 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027123.4-2186s21c1
Sequence:CCGGAGCCACTCTATGGAAATTATGCTCGAGCATAATTTCCATAGAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1563s21c1
Sequence:CCGGGCAAGGTAAAGAGTCATATTTCTCGAGAAATATGACTCTTTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1344s21c1
Sequence:CCGGTAGTCAGATTGCCGAGCTAATCTCGAGATTAGCTCGGCAATCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-2094s21c1
Sequence:CCGGCTCCGCTGTCCACTGGTAATACTCGAGTATTACCAGTGGACAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1430s21c1
Sequence:CCGGATGTGCTCTGTGCCCGTTTACCTCGAGGTAAACGGGCACAGAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027123.2-1782s1c1
Sequence:CCGGCAAAGGTGTTGACGCCCTATTCTCGAGAATAGGGCGTCAACACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-457s1c1
Sequence:CCGGGCTGAGTTTCATAAGTGCCCTCTCGAGAGGGCACTTATGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-1352s1c1
Sequence:CCGGGAGCCATTTGGAAAGCTCAATCTCGAGATTGAGCTTTCCAAATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027123.2-2120s1c1
Sequence:CCGGGCTTACATCAAGACTTGAGTTCTCGAGAACTCAAGTCTTGATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-279s1c1
Sequence:CCGGGATTCCATCACGCATACTGTACTCGAGTACAGTATGCGTGATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027123
VALIDATED
FASTKD3 MISSION shRNA Lentiviral Transduction Particles
FAST kinase domains 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027123.4-2186s21c1
Sequence:CCGGAGCCACTCTATGGAAATTATGCTCGAGCATAATTTCCATAGAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1563s21c1
Sequence:CCGGGCAAGGTAAAGAGTCATATTTCTCGAGAAATATGACTCTTTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1344s21c1
Sequence:CCGGTAGTCAGATTGCCGAGCTAATCTCGAGATTAGCTCGGCAATCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-2094s21c1
Sequence:CCGGCTCCGCTGTCCACTGGTAATACTCGAGTATTACCAGTGGACAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027123.4-1430s21c1
Sequence:CCGGATGTGCTCTGTGCCCGTTTACCTCGAGGTAAACGGGCACAGAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027123.2-1782s1c1
Sequence:CCGGCAAAGGTGTTGACGCCCTATTCTCGAGAATAGGGCGTCAACACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-457s1c1
Sequence:CCGGGCTGAGTTTCATAAGTGCCCTCTCGAGAGGGCACTTATGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-1352s1c1
Sequence:CCGGGAGCCATTTGGAAAGCTCAATCTCGAGATTGAGCTTTCCAAATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027123.2-2120s1c1
Sequence:CCGGGCTTACATCAAGACTTGAGTTCTCGAGAACTCAAGTCTTGATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027123.2-279s1c1
Sequence:CCGGGATTCCATCACGCATACTGTACTCGAGTACAGTATGCGTGATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024091
VALIDATED
FASTKD3 MISSION shRNA Bacterial Glycerol Stock
FAST kinase domains 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-2128s21c1
Sequence:GTACCGGTACTGACTTCAGAACTCAAACCTCGAGGTTTGAGTTCTGAAGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024091.2-1378s21c1
Sequence:CCGGCATTTGGGAAACTCAATTATTCTCGAGAATAATTGAGTTTCCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-1352s21c1
Sequence:CCGGTCGTCAGATTTCTGCGTTAATCTCGAGATTAACGCAGAAATCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-1144s21c1
Sequence:CCGGGAGTCTTGGAGGCGTTCATATCTCGAGATATGAACGCCTCCAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024091.2-1884s21c1
Sequence:CCGGGCTAATGAAGATATCCATAAACTCGAGTTTATGGATATCTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-2053s1c1
Sequence:CCGGCAAGACGTGAATTGGTGGAATCTCGAGATTCCACCAATTCACGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024091.2-1876s1c1
Sequence:CCGGCATCCACAGCTAATGAAGATACTCGAGTATCTTCATTAGCTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024091.2-808s1c1
Sequence:CCGGGTCTGATTACACTGCACAGTTCTCGAGAACTGTGCAGTGTAATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024091.2-1512s1c1
Sequence:CCGGGAATGCCATCCAGTCAACTTTCTCGAGAAAGTTGACTGGATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-469s1c1
Sequence:CCGGCATCAGAAGAAGTGCTAAGTTCTCGAGAACTTAGCACTTCTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024091.2-2239s1c1
Sequence:CCGGGATCTGAAAGCATCTGTAGTTCTCGAGAACTACAGATGCTTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-2003s1c1
Sequence:CCGGCGGTTATCAAGTTGTTCAGATCTCGAGATCTGAACAACTTGATAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-945s1c1
Sequence:CCGGGTGGATGAACACCAAACATTTCTCGAGAAATGTTTGGTGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-772s1c1
Sequence:CCGGGCATGGAAGTTCGCAATCTTTCTCGAGAAAGATTGCGAACTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024091
VALIDATED
FASTKD3 MISSION shRNA shRNA Plasmid DNA
FAST kinase domains 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-2128s21c1
Sequence:GTACCGGTACTGACTTCAGAACTCAAACCTCGAGGTTTGAGTTCTGAAGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024091.2-1378s21c1
Sequence:CCGGCATTTGGGAAACTCAATTATTCTCGAGAATAATTGAGTTTCCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-1352s21c1
Sequence:CCGGTCGTCAGATTTCTGCGTTAATCTCGAGATTAACGCAGAAATCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-1144s21c1
Sequence:CCGGGAGTCTTGGAGGCGTTCATATCTCGAGATATGAACGCCTCCAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024091.2-1884s21c1
Sequence:CCGGGCTAATGAAGATATCCATAAACTCGAGTTTATGGATATCTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-2053s1c1
Sequence:CCGGCAAGACGTGAATTGGTGGAATCTCGAGATTCCACCAATTCACGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024091.2-1876s1c1
Sequence:CCGGCATCCACAGCTAATGAAGATACTCGAGTATCTTCATTAGCTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024091.2-808s1c1
Sequence:CCGGGTCTGATTACACTGCACAGTTCTCGAGAACTGTGCAGTGTAATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024091.2-1512s1c1
Sequence:CCGGGAATGCCATCCAGTCAACTTTCTCGAGAAAGTTGACTGGATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-469s1c1
Sequence:CCGGCATCAGAAGAAGTGCTAAGTTCTCGAGAACTTAGCACTTCTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024091.2-2239s1c1
Sequence:CCGGGATCTGAAAGCATCTGTAGTTCTCGAGAACTACAGATGCTTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-2003s1c1
Sequence:CCGGCGGTTATCAAGTTGTTCAGATCTCGAGATCTGAACAACTTGATAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-945s1c1
Sequence:CCGGGTGGATGAACACCAAACATTTCTCGAGAAATGTTTGGTGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-772s1c1
Sequence:CCGGGCATGGAAGTTCGCAATCTTTCTCGAGAAAGATTGCGAACTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024091
VALIDATED
FASTKD3 MISSION shRNA Lentiviral Transduction Particles
FAST kinase domains 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-2128s21c1
Sequence:GTACCGGTACTGACTTCAGAACTCAAACCTCGAGGTTTGAGTTCTGAAGTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024091.2-1378s21c1
Sequence:CCGGCATTTGGGAAACTCAATTATTCTCGAGAATAATTGAGTTTCCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-1352s21c1
Sequence:CCGGTCGTCAGATTTCTGCGTTAATCTCGAGATTAACGCAGAAATCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024091.2-1144s21c1
Sequence:CCGGGAGTCTTGGAGGCGTTCATATCTCGAGATATGAACGCCTCCAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024091.2-1884s21c1
Sequence:CCGGGCTAATGAAGATATCCATAAACTCGAGTTTATGGATATCTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-2053s1c1
Sequence:CCGGCAAGACGTGAATTGGTGGAATCTCGAGATTCCACCAATTCACGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024091.2-1876s1c1
Sequence:CCGGCATCCACAGCTAATGAAGATACTCGAGTATCTTCATTAGCTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024091.2-808s1c1
Sequence:CCGGGTCTGATTACACTGCACAGTTCTCGAGAACTGTGCAGTGTAATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024091.2-1512s1c1
Sequence:CCGGGAATGCCATCCAGTCAACTTTCTCGAGAAAGTTGACTGGATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-469s1c1
Sequence:CCGGCATCAGAAGAAGTGCTAAGTTCTCGAGAACTTAGCACTTCTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024091.2-2239s1c1
Sequence:CCGGGATCTGAAAGCATCTGTAGTTCTCGAGAACTACAGATGCTTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-2003s1c1
Sequence:CCGGCGGTTATCAAGTTGTTCAGATCTCGAGATCTGAACAACTTGATAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-945s1c1
Sequence:CCGGGTGGATGAACACCAAACATTTCTCGAGAAATGTTTGGTGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024091.2-772s1c1
Sequence:CCGGGCATGGAAGTTCGCAATCTTTCTCGAGAAAGATTGCGAACTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks