EMAIL THIS PAGE TO A FRIEND

FASTKD5

FAST kinase domains 5

59 Gene Product Result for
Synonyms: dJ1187M17.5
UniProtKB ID: Q7L8L6, Q96JN3, Q9H5D1, Q9H8Y3
Gene ID:
Mouse(380601) FAST kinase domains 5
Rat(366192) FAST kinase domains 5
chicken(422937) FAST kinase domains 5
dog(100684685) FAST kinase domains 5
Horse(100052656) FAST kinase domains 5
cow(788680) FAST kinase domains 5
sheep(101123059) FAST kinase domains 5
naked mole-rat(101729695) FAST kinase domains 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021826 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021826 Rosetta Predictions human pricing
XM_001081175 Rosetta Predictions rat pricing
XM_345435 Rosetta Predictions rat pricing
NM_198176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355139 predicted 1795
2 SASI_Hs02_00355140 predicted 889
3 SASI_Hs02_00355141 predicted 439
4 SASI_Hs01_00239204 predicted 1602
5 SASI_Hs01_00239206 predicted 1930
6 SASI_Hs01_00239207 predicted 310
7 SASI_Hs01_00239208 predicted 1825
8 SASI_Hs01_00239209 predicted 1324
9 SASI_Hs01_00239210 predicted 557
10 SASI_Hs01_00239212 predicted 1212
11 SASI_Hs01_00239203 predicted 625
12 SASI_Hs01_00239205 predicted 1376
13 SASI_Hs01_00239211 predicted 1880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370911 predicted 2387
2 SASI_Rn02_00370912 predicted 1575
3 SASI_Rn02_00370913 predicted 2600
4 SASI_Rn02_00370914 predicted 2151
5 SASI_Rn02_00370915 predicted 2605
6 SASI_Rn02_00370916 predicted 1763
7 SASI_Rn02_00370917 predicted 1283
8 SASI_Rn02_00370918 predicted 1796
9 SASI_Rn02_00370919 predicted 1829
10 SASI_Rn02_00370920 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398367 predicted 1359
2 SASI_Rn02_00398368 predicted 1290
3 SASI_Rn02_00398369 predicted 1363
4 SASI_Rn02_00398370 predicted 1324
5 SASI_Rn02_00398371 predicted 1286
6 SASI_Rn02_00398372 predicted 1284
7 SASI_Rn02_00398373 predicted 1315
8 SASI_Rn02_00398374 predicted 1357
9 SASI_Rn02_00398375 predicted 1358
10 SASI_Rn02_00398376 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052673 predicted 1869
2 SASI_Mm02_00350879 predicted 2360
3 SASI_Mm01_00052674 predicted 1399
4 SASI_Mm01_00052675 predicted 1823
5 SASI_Mm01_00052677 predicted 1947
6 SASI_Mm01_00052678 predicted 2467
7 SASI_Mm01_00052679 predicted 1924
8 SASI_Mm02_00350880 predicted 2518
9 SASI_Mm01_00052680 predicted 2621
10 SASI_Mm01_00052681 predicted 2626
11 SASI_Mm01_00052672 predicted 2230
12 SASI_Mm01_00052676 predicted 1918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198176
VALIDATED
FASTKD5 MISSION shRNA Bacterial Glycerol Stock
FAST kinase domains 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-862s1c1
Sequence:CCGGGCCAGAAGTCATAACTAATTACTCGAGTAATTAGTTATGACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-1476s1c1
Sequence:CCGGGCTTCACTCATGTAGATCATACTCGAGTATGATCTACATGAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-2104s1c1
Sequence:CCGGCCAGTACATTAAGCACCATATCTCGAGATATGGTGCTTAATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-1053s1c1
Sequence:CCGGCCATGCTAGATGTGTATGAAACTCGAGTTTCATACACATCTAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-806s1c1
Sequence:CCGGGCTTCAGAAGTTGAACTAATTCTCGAGAATTAGTTCAACTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-806s21c1
Sequence:CCGGGCTTCAGAAGTTGAACTAATTCTCGAGAATTAGTTCAACTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-992s21c1
Sequence:CCGGACCTCCGATCTGATCAGTATTCTCGAGAATACTGATCAGATCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198176.1-2868s21c1
Sequence:CCGGCACCTCTAGTCTCAAGTATTTCTCGAGAAATACTTGAGACTAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-862s21c1
Sequence:CCGGGCCAGAAGTCATAACTAATTACTCGAGTAATTAGTTATGACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-1476s21c1
Sequence:CCGGGCTTCACTCATGTAGATCATACTCGAGTATGATCTACATGAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198176
VALIDATED
FASTKD5 MISSION shRNA shRNA Plasmid DNA
FAST kinase domains 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-862s1c1
Sequence:CCGGGCCAGAAGTCATAACTAATTACTCGAGTAATTAGTTATGACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-1476s1c1
Sequence:CCGGGCTTCACTCATGTAGATCATACTCGAGTATGATCTACATGAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-2104s1c1
Sequence:CCGGCCAGTACATTAAGCACCATATCTCGAGATATGGTGCTTAATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-1053s1c1
Sequence:CCGGCCATGCTAGATGTGTATGAAACTCGAGTTTCATACACATCTAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-806s1c1
Sequence:CCGGGCTTCAGAAGTTGAACTAATTCTCGAGAATTAGTTCAACTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-806s21c1
Sequence:CCGGGCTTCAGAAGTTGAACTAATTCTCGAGAATTAGTTCAACTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-992s21c1
Sequence:CCGGACCTCCGATCTGATCAGTATTCTCGAGAATACTGATCAGATCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198176.1-2868s21c1
Sequence:CCGGCACCTCTAGTCTCAAGTATTTCTCGAGAAATACTTGAGACTAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-862s21c1
Sequence:CCGGGCCAGAAGTCATAACTAATTACTCGAGTAATTAGTTATGACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-1476s21c1
Sequence:CCGGGCTTCACTCATGTAGATCATACTCGAGTATGATCTACATGAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198176
VALIDATED
FASTKD5 MISSION shRNA Lentiviral Transduction Particles
FAST kinase domains 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-862s1c1
Sequence:CCGGGCCAGAAGTCATAACTAATTACTCGAGTAATTAGTTATGACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-1476s1c1
Sequence:CCGGGCTTCACTCATGTAGATCATACTCGAGTATGATCTACATGAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-2104s1c1
Sequence:CCGGCCAGTACATTAAGCACCATATCTCGAGATATGGTGCTTAATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-1053s1c1
Sequence:CCGGCCATGCTAGATGTGTATGAAACTCGAGTTTCATACACATCTAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198176.1-806s1c1
Sequence:CCGGGCTTCAGAAGTTGAACTAATTCTCGAGAATTAGTTCAACTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-806s21c1
Sequence:CCGGGCTTCAGAAGTTGAACTAATTCTCGAGAATTAGTTCAACTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-992s21c1
Sequence:CCGGACCTCCGATCTGATCAGTATTCTCGAGAATACTGATCAGATCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198176.1-2868s21c1
Sequence:CCGGCACCTCTAGTCTCAAGTATTTCTCGAGAAATACTTGAGACTAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-862s21c1
Sequence:CCGGGCCAGAAGTCATAACTAATTACTCGAGTAATTAGTTATGACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198176.1-1476s21c1
Sequence:CCGGGCTTCACTCATGTAGATCATACTCGAGTATGATCTACATGAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021826
VALIDATED
FASTKD5 MISSION shRNA Bacterial Glycerol Stock
FAST kinase domains 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-2682s1c1
Sequence:CCGGCCAGAATGTAAGTTTGGCGATCTCGAGATCGCCAAACTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021826.4-1602s1c1
Sequence:CCGGGCCAAGATTCTGTGGTCATTTCTCGAGAAATGACCACAGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021826.4-789s1c1
Sequence:CCGGGCTCAAGTCATTGTTGATTATCTCGAGATAATCAACAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-1341s1c1
Sequence:CCGGGCTTGTGCTAACATTCAGCATCTCGAGATGCTGAATGTTAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-1943s1c1
Sequence:CCGGGCTGTGGTATTTAGCAGAGAACTCGAGTTCTCTGCTAAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021826.4-1341s21c1
Sequence:CCGGGCTTGTGCTAACATTCAGCATCTCGAGATGCTGAATGTTAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-2682s21c1
Sequence:CCGGCCAGAATGTAAGTTTGGCGATCTCGAGATCGCCAAACTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-1943s21c1
Sequence:CCGGGCTGTGGTATTTAGCAGAGAACTCGAGTTCTCTGCTAAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-789s21c1
Sequence:CCGGGCTCAAGTCATTGTTGATTATCTCGAGATAATCAACAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021826
VALIDATED
FASTKD5 MISSION shRNA shRNA Plasmid DNA
FAST kinase domains 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-2682s1c1
Sequence:CCGGCCAGAATGTAAGTTTGGCGATCTCGAGATCGCCAAACTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021826.4-1602s1c1
Sequence:CCGGGCCAAGATTCTGTGGTCATTTCTCGAGAAATGACCACAGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021826.4-789s1c1
Sequence:CCGGGCTCAAGTCATTGTTGATTATCTCGAGATAATCAACAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-1341s1c1
Sequence:CCGGGCTTGTGCTAACATTCAGCATCTCGAGATGCTGAATGTTAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-1943s1c1
Sequence:CCGGGCTGTGGTATTTAGCAGAGAACTCGAGTTCTCTGCTAAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021826.4-1341s21c1
Sequence:CCGGGCTTGTGCTAACATTCAGCATCTCGAGATGCTGAATGTTAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-2682s21c1
Sequence:CCGGCCAGAATGTAAGTTTGGCGATCTCGAGATCGCCAAACTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-1943s21c1
Sequence:CCGGGCTGTGGTATTTAGCAGAGAACTCGAGTTCTCTGCTAAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-789s21c1
Sequence:CCGGGCTCAAGTCATTGTTGATTATCTCGAGATAATCAACAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021826
VALIDATED
FASTKD5 MISSION shRNA Lentiviral Transduction Particles
FAST kinase domains 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-2682s1c1
Sequence:CCGGCCAGAATGTAAGTTTGGCGATCTCGAGATCGCCAAACTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021826.4-1602s1c1
Sequence:CCGGGCCAAGATTCTGTGGTCATTTCTCGAGAAATGACCACAGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021826.4-789s1c1
Sequence:CCGGGCTCAAGTCATTGTTGATTATCTCGAGATAATCAACAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-1341s1c1
Sequence:CCGGGCTTGTGCTAACATTCAGCATCTCGAGATGCTGAATGTTAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021826.4-1943s1c1
Sequence:CCGGGCTGTGGTATTTAGCAGAGAACTCGAGTTCTCTGCTAAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021826.4-1341s21c1
Sequence:CCGGGCTTGTGCTAACATTCAGCATCTCGAGATGCTGAATGTTAGCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-2682s21c1
Sequence:CCGGCCAGAATGTAAGTTTGGCGATCTCGAGATCGCCAAACTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-1943s21c1
Sequence:CCGGGCTGTGGTATTTAGCAGAGAACTCGAGTTCTCTGCTAAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021826.4-789s21c1
Sequence:CCGGGCTCAAGTCATTGTTGATTATCTCGAGATAATCAACAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks