EMAIL THIS PAGE TO A FRIEND

FAT1

FAT atypical cadherin 1

152 Gene Product Result for
Synonyms: CDHF7 CDHR8 FAT ME5 hFat1
UniProtKB ID: Q14517
Gene ID:
Human(2195) Summary: This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
Mouse(14107) FAT tumor suppressor homolog 1 (Drosophila)
Rat(83720) FAT atypical cadherin 1
Zebrafish(565591) FAT tumor suppressor homolog 1 (Drosophila)
domestic cat(101097804) FAT tumor suppressor homolog 1 (Drosophila)
cow(508251) FAT tumor suppressor homolog 1 (Drosophila)
Horse(100050525) FAT tumor suppressor homolog 1 (Drosophila)
dog(475621) FAT tumor suppressor homolog 1 (Drosophila)
chicken(395168) FAT tumor suppressor homolog 1 (Drosophila)
domestic guinea pig(100714667) FAT atypical cadherin 1
naked mole-rat(101720316) FAT atypical cadherin 1
sheep(101116884) FAT tumor suppressor homolog 1 (Drosophila)
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005245 Rosetta Predictions human pricing
NM_031819 Rosetta Predictions rat pricing
NM_001081286 Rosetta Predictions mouse pricing
XM_885736 Rosetta Predictions mouse pricing
XM_896341 Rosetta Predictions mouse pricing
XM_896404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232012 predicted 920
2 SASI_Hs02_00339256 predicted 3682
3 SASI_Hs02_00339257 predicted 6268
4 SASI_Hs01_00232013 predicted 10397
5 SASI_Hs01_00232014 predicted 4495
6 SASI_Hs01_00232016 predicted 5508
7 SASI_Hs02_00339258 predicted 5166
8 SASI_Hs01_00232017 predicted 11148
9 SASI_Hs02_00339259 predicted 5751
10 SASI_Hs01_00232019 predicted 4876
11 SASI_Hs01_00232015 predicted 9367
12 SASI_Hs01_00232018 predicted 10514
13 SASI_Hs01_00232020 predicted 2978
14 SASI_Hs01_00232021 predicted 3029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044027 predicted 6020
2 SASI_Rn01_00044028 predicted 9518
3 SASI_Rn01_00044029 predicted 2247
4 SASI_Rn01_00044030 predicted 10724
5 SASI_Rn01_00044031 predicted 9757
6 SASI_Rn01_00044032 predicted 12029
7 SASI_Rn02_00265290 predicted 4376
8 SASI_Rn01_00044034 predicted 956
9 SASI_Rn01_00044035 predicted 4890
10 SASI_Rn01_00044036 predicted 11774
11 SASI_Rn01_00044033 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296981 predicted 8851
2 SASI_Mm02_00296982 predicted 4950
3 SASI_Mm02_00296983 predicted 4436
4 SASI_Mm02_00296984 predicted 413
5 SASI_Mm02_00296985 predicted 7582
6 SASI_Mm02_00296986 predicted 2752
7 SASI_Mm02_00296987 predicted 12880
8 SASI_Mm02_00296988 predicted 12801
9 SASI_Mm02_00296989 predicted 9571
10 SASI_Mm02_00296990 predicted 9338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229932 predicted 8847
2 SASI_Mm01_00229933 predicted 1492
3 SASI_Mm01_00229934 predicted 4437
4 SASI_Mm01_00229935 predicted 414
5 SASI_Mm01_00229936 predicted 7586
6 SASI_Mm01_00229937 predicted 2745
7 SASI_Mm01_00229938 predicted 12867
8 SASI_Mm01_00229939 predicted 12792
9 SASI_Mm01_00229940 predicted 9570
10 SASI_Mm01_00229941 predicted 9339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224032 predicted 773
2 SASI_Mm01_00224033 predicted 704
3 SASI_Mm01_00224034 predicted 1244
4 SASI_Mm01_00224035 predicted 691
5 SASI_Mm01_00224036 predicted 1212
6 SASI_Mm01_00224037 predicted 938
7 SASI_Mm01_00224038 predicted 966
8 SASI_Mm01_00224039 predicted 1259
9 SASI_Mm01_00224040 predicted 793
10 SASI_Mm01_00224041 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265165 predicted 8853
2 SASI_Mm01_00265166 predicted 1490
3 SASI_Mm01_00265167 predicted 4432
4 SASI_Mm01_00265168 predicted 410
5 SASI_Mm01_00265169 predicted 7589
6 SASI_Mm01_00265170 predicted 2743
7 SASI_Mm01_00265171 predicted 12874
8 SASI_Mm01_00265172 predicted 12795
9 SASI_Mm01_00265173 predicted 9576
10 SASI_Mm01_00265174 predicted 9340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005245
VALIDATED
FAT1 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-7325s21c1
Sequence:CCGGCGTTACCGACCTCAATGATAACTCGAGTTATCATTGAGGTCGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005245.3-14090s21c1
Sequence:CCGGCTCTGGACGTGCTAGCCATTTCTCGAGAAATGGCTAGCACGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-7874s21c1
Sequence:CCGGAGTGATCTCAGTCCGTTTAATCTCGAGATTAAACGGACTGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-9700s21c1
Sequence:CCGGAGTTCTCCATTAACGAATTATCTCGAGATAATTCGTTAATGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-9638s21c1
Sequence:CCGGAGATGCCGACGCAGGATTAAACTCGAGTTTAATCCTGCGTCGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-5385s1c1
Sequence:CCGGGCCCATTTACACATTGATAATCTCGAGATTATCAATGTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-6937s1c1
Sequence:CCGGCCGGCATATAAGCTGAGCATACTCGAGTATGCTCAGCTTATATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005245.1-14429s1c1
Sequence:CCGGCCAGGGTTTCATTCTGTCTTTCTCGAGAAAGACAGAATGAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-3609s1c1
Sequence:CCGGGCCTGTTTATTACCCAGAAATCTCGAGATTTCTGGGTAATAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005245
VALIDATED
FAT1 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-7325s21c1
Sequence:CCGGCGTTACCGACCTCAATGATAACTCGAGTTATCATTGAGGTCGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005245.3-14090s21c1
Sequence:CCGGCTCTGGACGTGCTAGCCATTTCTCGAGAAATGGCTAGCACGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-7874s21c1
Sequence:CCGGAGTGATCTCAGTCCGTTTAATCTCGAGATTAAACGGACTGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-9700s21c1
Sequence:CCGGAGTTCTCCATTAACGAATTATCTCGAGATAATTCGTTAATGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-9638s21c1
Sequence:CCGGAGATGCCGACGCAGGATTAAACTCGAGTTTAATCCTGCGTCGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-5385s1c1
Sequence:CCGGGCCCATTTACACATTGATAATCTCGAGATTATCAATGTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-6937s1c1
Sequence:CCGGCCGGCATATAAGCTGAGCATACTCGAGTATGCTCAGCTTATATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005245.1-14429s1c1
Sequence:CCGGCCAGGGTTTCATTCTGTCTTTCTCGAGAAAGACAGAATGAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-3609s1c1
Sequence:CCGGGCCTGTTTATTACCCAGAAATCTCGAGATTTCTGGGTAATAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005245
VALIDATED
FAT1 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-7325s21c1
Sequence:CCGGCGTTACCGACCTCAATGATAACTCGAGTTATCATTGAGGTCGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005245.3-14090s21c1
Sequence:CCGGCTCTGGACGTGCTAGCCATTTCTCGAGAAATGGCTAGCACGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-7874s21c1
Sequence:CCGGAGTGATCTCAGTCCGTTTAATCTCGAGATTAAACGGACTGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-9700s21c1
Sequence:CCGGAGTTCTCCATTAACGAATTATCTCGAGATAATTCGTTAATGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005245.3-9638s21c1
Sequence:CCGGAGATGCCGACGCAGGATTAAACTCGAGTTTAATCCTGCGTCGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-5385s1c1
Sequence:CCGGGCCCATTTACACATTGATAATCTCGAGATTATCAATGTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-6937s1c1
Sequence:CCGGCCGGCATATAAGCTGAGCATACTCGAGTATGCTCAGCTTATATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005245.1-14429s1c1
Sequence:CCGGCCAGGGTTTCATTCTGTCTTTCTCGAGAAAGACAGAATGAAACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005245.1-3609s1c1
Sequence:CCGGGCCTGTTTATTACCCAGAAATCTCGAGATTTCTGGGTAATAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010179
VALIDATED
FAT1 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010179.1-13436s1c1
Sequence:CCGGCGGTGAATAAAGAAGAATCTTCTCGAGAAGATTCTTCTTTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010179.1-1858s1c1
Sequence:CCGGCGCCACGATTACTCTCAATAACTCGAGTTATTGAGAGTAATCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-12737s1c1
Sequence:CCGGGCCGAGGGAATAGGTATTATTCTCGAGAATAATACCTATTCCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-6489s1c1
Sequence:CCGGGCCACGTCATTCGCTATGTTACTCGAGTAACATAGCGAATGACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-2981s1c1
Sequence:CCGGCCACCCAATTACTCAGTGAAACTCGAGTTTCACTGAGTAATTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010179
VALIDATED
FAT1 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010179.1-13436s1c1
Sequence:CCGGCGGTGAATAAAGAAGAATCTTCTCGAGAAGATTCTTCTTTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010179.1-1858s1c1
Sequence:CCGGCGCCACGATTACTCTCAATAACTCGAGTTATTGAGAGTAATCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-12737s1c1
Sequence:CCGGGCCGAGGGAATAGGTATTATTCTCGAGAATAATACCTATTCCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-6489s1c1
Sequence:CCGGGCCACGTCATTCGCTATGTTACTCGAGTAACATAGCGAATGACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-2981s1c1
Sequence:CCGGCCACCCAATTACTCAGTGAAACTCGAGTTTCACTGAGTAATTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010179
VALIDATED
FAT1 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010179.1-13436s1c1
Sequence:CCGGCGGTGAATAAAGAAGAATCTTCTCGAGAAGATTCTTCTTTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010179.1-1858s1c1
Sequence:CCGGCGCCACGATTACTCTCAATAACTCGAGTTATTGAGAGTAATCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-12737s1c1
Sequence:CCGGGCCGAGGGAATAGGTATTATTCTCGAGAATAATACCTATTCCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-6489s1c1
Sequence:CCGGGCCACGTCATTCGCTATGTTACTCGAGTAACATAGCGAATGACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010179.1-2981s1c1
Sequence:CCGGCCACCCAATTACTCAGTGAAACTCGAGTTTCACTGAGTAATTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks