EMAIL THIS PAGE TO A FRIEND

FAT2

FAT atypical cadherin 2

130 Gene Product Result for
Synonyms: CDHF8 CDHR9 HFAT2 MEGF1
UniProtKB ID: Q9NYQ8, O75091, Q9NSR7
Gene ID:
Human(2196) Summary: This gene is the second identified human homolog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has two epidermal growth factor (EGF)-like repeats and one laminin G domain. This protein most likely functions as a cell adhesion molecule, controlling cell proliferation and playing an important role in cerebellum development. [provided by RefSeq, Jul 2008]
Mouse(245827) FAT tumor suppressor homolog 2 (Drosophila)
Rat(65048) FAT atypical cadherin 2
Zebrafish(568468) FAT tumor suppressor homolog 2 (Drosophila)
chicken(416266) FAT tumor suppressor homolog 2 (Drosophila)
cow(523046) FAT tumor suppressor homolog 2 (Drosophila)
domestic cat(101084423) FAT tumor suppressor homolog 2 (Drosophila)
dog(479323) FAT tumor suppressor homolog 2 (Drosophila)
sheep(101106258) FAT tumor suppressor homolog 2 (Drosophila)
Domestic Rabbit(100347471) FAT tumor suppressor homolog 2 (Drosophila)
naked mole-rat(101698666) FAT atypical cadherin 2
domestic guinea pig(100725177) FAT atypical cadherin 2
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001447 Rosetta Predictions human pricing
NM_022954 Rosetta Predictions rat pricing
NM_001029988 Rosetta Predictions mouse pricing
XM_888554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331872 predicted 1294
2 SASI_Hs01_00223973 predicted 7028
3 SASI_Hs01_00223974 predicted 2660
4 SASI_Hs01_00223976 predicted 8212
5 SASI_Hs01_00223977 predicted 6071
6 SASI_Hs02_00331873 predicted 7214
7 SASI_Hs01_00223978 predicted 11706
8 SASI_Hs01_00223979 predicted 3306
9 SASI_Hs01_00223980 predicted 2543
10 SASI_Hs02_00331874 predicted 11713
11 SASI_Hs01_00223975 predicted 7510
12 SASI_Hs01_00223981 predicted 9456
13 SASI_Hs01_00223982 predicted 4962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092187 predicted 9731
2 SASI_Rn01_00092188 predicted 7047
3 SASI_Rn02_00263687 predicted 8876
4 SASI_Rn01_00092189 predicted 3423
5 SASI_Rn01_00092194 predicted 7571
6 SASI_Rn01_00092195 predicted 7982
7 SASI_Rn01_00092196 predicted 3514
8 SASI_Rn02_00263688 predicted 10037
9 SASI_Rn02_00263689 predicted 11740
10 SASI_Rn02_00263690 predicted 6759
11 SASI_Rn01_00092190 predicted 2220
12 SASI_Rn01_00092191 predicted 4696
13 SASI_Rn01_00092192 predicted 5510
14 SASI_Rn01_00092193 predicted 12277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288090 predicted 6929
2 SASI_Mm02_00288091 predicted 1863
3 SASI_Mm02_00288092 predicted 5950
4 SASI_Mm02_00288093 predicted 4681
5 SASI_Mm02_00288094 predicted 11759
6 SASI_Mm02_00288095 predicted 7466
7 SASI_Mm02_00288096 predicted 9918
8 SASI_Mm02_00288097 predicted 4600
9 SASI_Mm02_00288098 predicted 11775
10 SASI_Mm02_00288099 predicted 3303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284890 predicted 6918
2 SASI_Mm01_00284891 predicted 10495
3 SASI_Mm01_00284892 predicted 1865
4 SASI_Mm01_00284893 predicted 5948
5 SASI_Mm01_00284894 predicted 6376
6 SASI_Mm01_00284895 predicted 4668
7 SASI_Mm01_00284896 predicted 11755
8 SASI_Mm01_00284897 predicted 7461
9 SASI_Mm01_00284898 predicted 9908
10 SASI_Mm01_00284899 predicted 4597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029988
FAT2 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029988.1-13923s1c1
Sequence:CCGGGCCAAGAACAAGAAGGATGTACTCGAGTACATCCTTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-4771s1c1
Sequence:CCGGCCTCGTTATGAGGCAAATGTTCTCGAGAACATTTGCCTCATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-11540s1c1
Sequence:CCGGCCAATGAAACAGCCTCTATTTCTCGAGAAATAGAGGCTGTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-206s1c1
Sequence:CCGGCCCTATACAATGCCACCATTTCTCGAGAAATGGTGGCATTGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-640s1c1
Sequence:CCGGGCCGAGTTCTATTACGCCTTTCTCGAGAAAGGCGTAATAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029988
FAT2 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029988.1-13923s1c1
Sequence:CCGGGCCAAGAACAAGAAGGATGTACTCGAGTACATCCTTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-4771s1c1
Sequence:CCGGCCTCGTTATGAGGCAAATGTTCTCGAGAACATTTGCCTCATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-11540s1c1
Sequence:CCGGCCAATGAAACAGCCTCTATTTCTCGAGAAATAGAGGCTGTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-206s1c1
Sequence:CCGGCCCTATACAATGCCACCATTTCTCGAGAAATGGTGGCATTGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-640s1c1
Sequence:CCGGGCCGAGTTCTATTACGCCTTTCTCGAGAAAGGCGTAATAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029988
FAT2 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029988.1-13923s1c1
Sequence:CCGGGCCAAGAACAAGAAGGATGTACTCGAGTACATCCTTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-4771s1c1
Sequence:CCGGCCTCGTTATGAGGCAAATGTTCTCGAGAACATTTGCCTCATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-11540s1c1
Sequence:CCGGCCAATGAAACAGCCTCTATTTCTCGAGAAATAGAGGCTGTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-206s1c1
Sequence:CCGGCCCTATACAATGCCACCATTTCTCGAGAAATGGTGGCATTGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029988.1-640s1c1
Sequence:CCGGGCCGAGTTCTATTACGCCTTTCTCGAGAAAGGCGTAATAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001447
VALIDATED
FAT2 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001447.1-13824s1c1
Sequence:CCGGGCTCTGAACCTTCTTTGTTAACTCGAGTTAACAAAGAAGGTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001447.1-7008s1c1
Sequence:CCGGCCACAGTTCAAGAACTGGATTCTCGAGAATCCAGTTCTTGAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-4842s1c1
Sequence:CCGGGCATCATTACTCTAGCTCAAACTCGAGTTTGAGCTAGAGTAATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-2782s1c1
Sequence:CCGGCCAGTGCATCACAGAACACAACTCGAGTTGTGTTCTGTGATGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-11209s1c1
Sequence:CCGGCCAGGGTCAAATCTGCCATAACTCGAGTTATGGCAGATTTGACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-1745s21c2
Sequence:CCGGCCAGTAGGGAAATCGATAATGCTCGAGCATTATCGATTTCCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-8401s21c2
Sequence:CCGGATTTGAGGCTGATCCATATAACTCGAGTTATATGGATCAGCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-5983s21c2
Sequence:CCGGTGGTGCCCAGGGCAATCATTTCTCGAGAAATGATTGCCCTGGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001447.2-14106s21c2
Sequence:CCGGACGCCTGCCCATCAAGTATTACTCGAGTAATACTTGATGGGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-3317s21c2
Sequence:GTACCGGTACTACTGGTTGACGGTATTACTCGAGTAATACCGTCAACCAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001447
VALIDATED
FAT2 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001447.1-13824s1c1
Sequence:CCGGGCTCTGAACCTTCTTTGTTAACTCGAGTTAACAAAGAAGGTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001447.1-7008s1c1
Sequence:CCGGCCACAGTTCAAGAACTGGATTCTCGAGAATCCAGTTCTTGAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-4842s1c1
Sequence:CCGGGCATCATTACTCTAGCTCAAACTCGAGTTTGAGCTAGAGTAATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-2782s1c1
Sequence:CCGGCCAGTGCATCACAGAACACAACTCGAGTTGTGTTCTGTGATGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-11209s1c1
Sequence:CCGGCCAGGGTCAAATCTGCCATAACTCGAGTTATGGCAGATTTGACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-1745s21c2
Sequence:CCGGCCAGTAGGGAAATCGATAATGCTCGAGCATTATCGATTTCCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-8401s21c2
Sequence:CCGGATTTGAGGCTGATCCATATAACTCGAGTTATATGGATCAGCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-5983s21c2
Sequence:CCGGTGGTGCCCAGGGCAATCATTTCTCGAGAAATGATTGCCCTGGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001447.2-14106s21c2
Sequence:CCGGACGCCTGCCCATCAAGTATTACTCGAGTAATACTTGATGGGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-3317s21c2
Sequence:GTACCGGTACTACTGGTTGACGGTATTACTCGAGTAATACCGTCAACCAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001447
VALIDATED
FAT2 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001447.1-13824s1c1
Sequence:CCGGGCTCTGAACCTTCTTTGTTAACTCGAGTTAACAAAGAAGGTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001447.1-7008s1c1
Sequence:CCGGCCACAGTTCAAGAACTGGATTCTCGAGAATCCAGTTCTTGAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-4842s1c1
Sequence:CCGGGCATCATTACTCTAGCTCAAACTCGAGTTTGAGCTAGAGTAATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-2782s1c1
Sequence:CCGGCCAGTGCATCACAGAACACAACTCGAGTTGTGTTCTGTGATGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001447.1-11209s1c1
Sequence:CCGGCCAGGGTCAAATCTGCCATAACTCGAGTTATGGCAGATTTGACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-1745s21c2
Sequence:CCGGCCAGTAGGGAAATCGATAATGCTCGAGCATTATCGATTTCCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-8401s21c2
Sequence:CCGGATTTGAGGCTGATCCATATAACTCGAGTTATATGGATCAGCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-5983s21c2
Sequence:CCGGTGGTGCCCAGGGCAATCATTTCTCGAGAAATGATTGCCCTGGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001447.2-14106s21c2
Sequence:CCGGACGCCTGCCCATCAAGTATTACTCGAGTAATACTTGATGGGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001447.2-3317s21c2
Sequence:GTACCGGTACTACTGGTTGACGGTATTACTCGAGTAATACCGTCAACCAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks