EMAIL THIS PAGE TO A FRIEND

FAT3

FAT atypical cadherin 3

224 Gene Product Result for
Synonyms: CDHF15 CDHR10
UniProtKB ID: Q8TDW7, B5MDB0, Q96AU6
Gene ID:
Mouse(270120) FAT tumor suppressor homolog 3 (Drosophila)
Rat(191571) FAT atypical cadherin 3
domestic guinea pig(100724646) FAT atypical cadherin 3
naked mole-rat(101699874) FAT atypical cadherin 3
sheep(101107744) FAT tumor suppressor homolog 3 (Drosophila)
chicken(395167) FAT tumor suppressor homolog 3 (Drosophila)
dog(476772) FAT tumor suppressor homolog 3 (Drosophila)
domestic cat(101084219) FAT tumor suppressor homolog 3 (Drosophila)
Horse(100059251) FAT tumor suppressor homolog 3 (Drosophila)
cow(536281) FAT tumor suppressor homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008781 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_061871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_061871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_061871 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001017984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008781 Rosetta Predictions human pricing
XM_926199 Rosetta Predictions human pricing
NM_138544 Rosetta Predictions rat pricing
NM_001080814 Rosetta Predictions mouse pricing
XM_356226 Rosetta Predictions mouse pricing
XM_897433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305570 predicted 3324
2 SASI_Hs02_00305571 predicted 8465
3 SASI_Hs02_00305572 predicted 232
4 SASI_Hs02_00305573 predicted 6801
5 SASI_Hs02_00305574 predicted 13234
6 SASI_Hs02_00305575 predicted 2608
7 SASI_Hs02_00305576 predicted 12552
8 SASI_Hs02_00305577 predicted 7078
9 SASI_Hs02_00305578 predicted 13574
10 SASI_Hs02_00305579 predicted 10248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297115 predicted 3435
2 SASI_Hs01_00297116 predicted 9221
3 SASI_Hs01_00297117 predicted 357
4 SASI_Hs01_00297118 predicted 2434
5 SASI_Hs01_00297119 predicted 6922
6 SASI_Hs01_00297120 predicted 13350
7 SASI_Hs01_00297121 predicted 2733
8 SASI_Hs01_00297122 predicted 2209
9 SASI_Hs01_00297123 predicted 2763
10 SASI_Hs01_00297124 predicted 12673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268183 predicted 11692
2 SASI_Rn01_00112621 predicted 3136
3 SASI_Rn01_00112622 predicted 3183
4 SASI_Rn01_00112624 predicted 1116
5 SASI_Rn02_00268184 predicted 7017
6 SASI_Rn01_00112625 predicted 7855
7 SASI_Rn01_00112626 predicted 4954
8 SASI_Rn01_00112628 predicted 2914
9 SASI_Rn02_00268185 predicted 610
10 SASI_Rn01_00112629 predicted 12832
11 SASI_Rn01_00112623 predicted 7930
12 SASI_Rn01_00112627 predicted 2402
13 SASI_Rn01_00112630 predicted 10400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293873 predicted 10098
2 SASI_Mm02_00293874 predicted 9705
3 SASI_Mm02_00293875 predicted 12947
4 SASI_Mm02_00293876 predicted 2896
5 SASI_Mm02_00293877 predicted 1431
6 SASI_Mm02_00293878 predicted 828
7 SASI_Mm02_00293879 predicted 7570
8 SASI_Mm02_00293880 predicted 9222
9 SASI_Mm02_00293881 predicted 13750
10 SASI_Mm02_00293882 predicted 9386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285487 predicted 10104
2 SASI_Mm01_00285488 predicted 9705
3 SASI_Mm01_00285489 predicted 12952
4 SASI_Mm01_00285490 predicted 2906
5 SASI_Mm01_00285491 predicted 6726
6 SASI_Mm01_00285492 predicted 830
7 SASI_Mm01_00285493 predicted 7573
8 SASI_Mm01_00285494 predicted 13763
9 SASI_Mm01_00285495 predicted 8445
10 SASI_Mm01_00285496 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278330 predicted 1046
2 SASI_Mm01_00278331 predicted 689
3 SASI_Mm01_00278332 predicted 313
4 SASI_Mm01_00278333 predicted 911
5 SASI_Mm01_00278334 predicted 1021
6 SASI_Mm01_00278335 predicted 445
7 SASI_Mm01_00278336 predicted 325
8 SASI_Mm01_00278337 predicted 233
9 SASI_Mm01_00278338 predicted 1091
10 SASI_Mm01_00278339 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008781
FAT3 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-1193s21c1
Sequence:CCGGTGTCGTGGTTGCTATAGTAAACTCGAGTTTACTATAGCAACCACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-2171s21c1
Sequence:CCGGTAATAGACAGGGACCATATTTCTCGAGAAATATGGTCCCTGTCTATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-2698s21c1
Sequence:CCGGGGGAATCCAAAGCCAATTATTCTCGAGAATAATTGGCTTTGGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008781.2-13963s21c1
Sequence:CCGGTTATTTCACCCACTAAGTTATCTCGAGATAACTTAGTGGGTGAAATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-656s21c1
Sequence:CCGGCTCCTTAAGTGGTCGATTAAACTCGAGTTTAATCGACCACTTAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008781
FAT3 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-1193s21c1
Sequence:CCGGTGTCGTGGTTGCTATAGTAAACTCGAGTTTACTATAGCAACCACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-2171s21c1
Sequence:CCGGTAATAGACAGGGACCATATTTCTCGAGAAATATGGTCCCTGTCTATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-2698s21c1
Sequence:CCGGGGGAATCCAAAGCCAATTATTCTCGAGAATAATTGGCTTTGGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008781.2-13963s21c1
Sequence:CCGGTTATTTCACCCACTAAGTTATCTCGAGATAACTTAGTGGGTGAAATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-656s21c1
Sequence:CCGGCTCCTTAAGTGGTCGATTAAACTCGAGTTTAATCGACCACTTAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008781
FAT3 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-1193s21c1
Sequence:CCGGTGTCGTGGTTGCTATAGTAAACTCGAGTTTACTATAGCAACCACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-2171s21c1
Sequence:CCGGTAATAGACAGGGACCATATTTCTCGAGAAATATGGTCCCTGTCTATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-2698s21c1
Sequence:CCGGGGGAATCCAAAGCCAATTATTCTCGAGAATAATTGGCTTTGGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008781.2-13963s21c1
Sequence:CCGGTTATTTCACCCACTAAGTTATCTCGAGATAACTTAGTGGGTGAAATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008781.2-656s21c1
Sequence:CCGGCTCCTTAAGTGGTCGATTAAACTCGAGTTTAATCGACCACTTAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_061871
FAT3 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000038104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-9379s1c1
Sequence:CCGGGCCCTGCTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-2440s1c1
Sequence:CCGGGCTGTGTTTGAGACTATCTTACTCGAGTAAGATAGTCTCAAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-745s1c1
Sequence:CCGGCGCCTCCACATTGAATGGATTCTCGAGAATCCATTCAATGTGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-7371s1c1
Sequence:CCGGCCAGCAAGTTTCTCACACTTACTCGAGTAAGTGTGAGAAACTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_061871
FAT3 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000038104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-9379s1c1
Sequence:CCGGGCCCTGCTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-2440s1c1
Sequence:CCGGGCTGTGTTTGAGACTATCTTACTCGAGTAAGATAGTCTCAAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-745s1c1
Sequence:CCGGCGCCTCCACATTGAATGGATTCTCGAGAATCCATTCAATGTGGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-7371s1c1
Sequence:CCGGCCAGCAAGTTTCTCACACTTACTCGAGTAAGTGTGAGAAACTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_061871
FAT3 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000038104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-9379s1c1
Sequence:CCGGGCCCTGCTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-2440s1c1
Sequence:CCGGGCTGTGTTTGAGACTATCTTACTCGAGTAAGATAGTCTCAAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-745s1c1
Sequence:CCGGCGCCTCCACATTGAATGGATTCTCGAGAATCCATTCAATGTGGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061871.7-7371s1c1
Sequence:CCGGCCAGCAAGTTTCTCACACTTACTCGAGTAAGTGTGAGAAACTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017984
FAT3 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017984.1-18186s1c1
Sequence:CCGGCCCACAACAAAGAGGACTTTACTCGAGTAAAGTCCTCTTTGTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-2356s1c1
Sequence:CCGGGCAGAGAAACTACTCATTAAACTCGAGTTTAATGAGTAGTTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-1027s1c1
Sequence:CCGGGCCAAACTTTATGTTCACATTCTCGAGAATGTGAACATAAAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-5935s1c1
Sequence:CCGGGCTGTGTTTGAAACTGTCTTACTCGAGTAAGACAGTTTCAAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-11633s1c1
Sequence:CCGGGCACCTGTAATGGAGGAGTTTCTCGAGAAACTCCTCCATTACAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017984
FAT3 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017984.1-18186s1c1
Sequence:CCGGCCCACAACAAAGAGGACTTTACTCGAGTAAAGTCCTCTTTGTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-2356s1c1
Sequence:CCGGGCAGAGAAACTACTCATTAAACTCGAGTTTAATGAGTAGTTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-1027s1c1
Sequence:CCGGGCCAAACTTTATGTTCACATTCTCGAGAATGTGAACATAAAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-5935s1c1
Sequence:CCGGGCTGTGTTTGAAACTGTCTTACTCGAGTAAGACAGTTTCAAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-11633s1c1
Sequence:CCGGGCACCTGTAATGGAGGAGTTTCTCGAGAAACTCCTCCATTACAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017984
FAT3 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017984.1-18186s1c1
Sequence:CCGGCCCACAACAAAGAGGACTTTACTCGAGTAAAGTCCTCTTTGTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-2356s1c1
Sequence:CCGGGCAGAGAAACTACTCATTAAACTCGAGTTTAATGAGTAGTTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-1027s1c1
Sequence:CCGGGCCAAACTTTATGTTCACATTCTCGAGAATGTGAACATAAAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-5935s1c1
Sequence:CCGGGCTGTGTTTGAAACTGTCTTACTCGAGTAAGACAGTTTCAAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017984.1-11633s1c1
Sequence:CCGGGCACCTGTAATGGAGGAGTTTCTCGAGAAACTCCTCCATTACAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)